teaching:progappchim:elements_molecules

Plan du site

Voici un plan du site de toutes les pages disponibles, triées par catégories.

      • algos_diversplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes divers

        Problèmes résolus :

        * Fizz buzz, jeu de comptage et de divisibilité conçu pour des enfants * ...

        Problèmes non résolus

        * Décomposition de formules chimiques (analyse de chaînes de caractères) * ...

        Classiques

        * Solving Travelling Salesperson Problems with Python

        Références diverses

        *
      • algos_entiersplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes sur entiers

        cf....... Cette page reprend quelques grands algorithmes classiques sur les nombres entiers, et introduit quelques algorithmes ayant des applications en chimie.

        Recherche du PGCD (plus grand commun diviseur)

        Explication géométrique : en comprenant un nombre entier comme une longueur et un couple d'entiers (a,b) comme un rectangle, leur PGCD est la longueur du côté du plus grand carré permettant de carreler entièrement ce rectangle. L'algorithme d'Euclide décompose ce re…
      • algos_graphesplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes de graphes

        Références diverses

        * * * * * * (depuis Python 3.9)
      • altair_simpleplugin-autotooltip__default plugin-autotooltip_bigles bases de Altair, une librairie graphique interactive

        * Altair: Declarative Visualization in Python — Altair 4.1.0 documentation * altair · PyPI * (Tutorial) Altair in Python: Data Visualizations - DataCamp * Python Interactive Data Visualization with Altair - Towards Data Science * Stackoverflow * python - Altair not rendering chart in jupyter notebook - Stack Overflow * python - Not able to display altair charts in jupyter notebook - Stack Overflow
      • analyse_imagesplugin-autotooltip__default plugin-autotooltip_bigAnalyse d'images

        Le traitement d'images permet de transformer des images. L'analyse d'images permet d'extraire des informations contenues dans une image. Il est aussi possible d'effectuer des tâches plus complexes de reconnaissance et d'analyse de scènes.
      • attracteur_lorenzplugin-autotooltip__default plugin-autotooltip_bigL'attracteur de Lorenz

        L'attracteur de Lorenz est un système d'équations différentielles ordinaires au comportement particulier, chaotique. C'est un exemple classique de nombreux cours scientifiques, et plusieurs sites proposent des solutions.

        Avec du code appliquant le méthode de Runge-Kutta d'ordre 4
      • bioinformaticplugin-autotooltip__default plugin-autotooltip_bigBioinformatique

        Manipulations de séquences ADN, ARN, protéines,...

        Compter les nucléotides d'une séquence ADN

        #!/usr/bin/env python # -*- coding: utf-8 -*- """ On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T') Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases """ adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

        # utilisation d'une liste et de la méthode .count() base…
      • bokeh_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Bokeh, une librairie pour des visualisations interactives dans un navigateur web

        * page d'entrée sur Bokeh * User guide * Galerie d'exemples * Bokeh dans les Jupyter notebooks * Bokeh tutorial in live Jupyter Notebooks * Reference guide

        * Réseaux sociaux : * Twitter * GitHub * Youtube

        Exemples scientifiques

        * Interactions sur la fonction sinus (amplitude, décalage vertical, fréquence, déphasage) +
      • calcul_matriciel_2012plugin-autotooltip__default plugin-autotooltip_bigCalul matriciel

        #!/usr/bin/env python # -*- coding: UTF-8 -*- # (pdf) # #pour operation matriciel verification mathématique : # #
      • codes_presentationplugin-autotooltip__default plugin-autotooltip_bigCodes de la présentation

        Turtle

        Cf. la documentation officielle.

        #!/usr/bin/python # -*- coding: UTF-8 -*-

        # exemple de base turtle # from turtle import * import sys import time

        reset() x=-100 y=-100 i=0 while i < 10: j=0 while j <10: up() goto(x+i*20,y+j*20) down() fill(1) n while <4 : forward(16) left(90) color([i*0.1,j*0.1,0]) fill(0) color(0,0,0) j =j…
      • collection_counter_exempleplugin-autotooltip__default plugin-autotooltip_bigExemple d'utilisation de Counter

        Module collections :

        * *

        #!/usr/bin/env python # -*- coding: utf-8 -*- “”“ Recherche du nombre d'occurences des noms d'auteurs d'un article On copie dans all_authors les noms des auteurs
      • collection_namedtuple_exempleplugin-autotooltip__default plugin-autotooltip_bigExemple d'utilisation de namedtuple

        L'utilisation de namedtuple peut s'avérer plus rapide que la définition de classes (objets)

        #!/usr/bin/env python # -*- coding: utf-8 -*-

        from collections import namedtuple
      • conversion_temperature_2011plugin-autotooltip__default plugin-autotooltip_bigConversion de températures

        #!/usr/bin/env python # -*- coding: utf-8 -*- # Conversion de témpératures # programme réalisé par AC&JD, ba2 chimie 2010-2011

        from Tkinter import *

        def delwidgets():
      • courbe_predominance_acide_2013plugin-autotooltip__default plugin-autotooltip_bigCourbe de Prédominance d'un Acide

        #!/usr/bin/env python # -*- coding: utf-8 -*- # travail de KH, ba2 chimie 2012-2013

        # Courbe de Prédominance d'un Acide # from math import * import matplotlib.pyplot as plt from Tkinter import *
      • csvplugin-autotooltip__default plugin-autotooltip_bigLire et écrire des fichiers de données csv

        pandas Les fichiers csv sont des fichiers de données séparées par des virgules (ou point-virgules), pour “comma separated values”. Comme ceci :

        1;0.1;3 2;0.3;5 3;0.5;7 4;0.6;11 5;0.9;21 6;1.5;39

        Ils peuvent être facilement importés ou exportés de tableurs ou logiciels de graphiques scientifiques.
      • dictionaries_adn_arn_proteinplugin-autotooltip__default plugin-autotooltip_bigTraduction ADN-ARN-protéine

        Avec l'interface Tk. Voir aussi le programme Traduction de l'ADN en séquence d'acides aminés (protéine) : utilisation d'un dictionnaire (type Python)

        #!/usr/bin/env python # -*- coding: utf-8 -*- “”“ Traduction de codes ADN en ARN et protéine. Basé sur le travail de NR et CVDD, ba2 chimie 2013-2014
      • dictionary_adn_proteinplugin-autotooltip__default plugin-autotooltip_bigTraduction de l'ADN en séquence d'acides aminés

        #!/usr/bin/env python # -*- coding: iso-8859-1 -*-

        # python code to translante DNA sequences into proteins # traduction de l'ADN en séquence d'acides aminés (protéine)
      • diffusion_chimique_1dplugin-autotooltip__default plugin-autotooltip_bigModélisation de la diffusion chimique dans un film

        Technique de différences finies, utilisation de matplotlib

        #!/usr/bin/env python # -*- coding: utf-8 -*- from math import * # pour utiliser la librairie graphique matplotlib from pylab import *
      • elements_moleculesplugin-autotooltip__default plugin-autotooltip_bigÉléments et molécules

        Les propriétés des éléments chimiques, de molécules peuvent être dressées, listées,... par un programme si on dispose des données. Christoph Gohlke (University of California, Irvine), a écrit une librairie molmass pour accéder aux propriétés des éléments, et calculer les masses moléculaires, compositions élémentaires, spectres de distribution des masses de molécules,
      • ensemble_mandelbrot_2013plugin-autotooltip__default plugin-autotooltip_bigEnsemble de Mandelbrot

        Dessin d'une fractale : l'ensemble de Mandelbrot

        #!/usr/bin/env python # -*- coding: utf-8 -*- # version un peu aménagée du travail de BF, ba2 chimie 2012-2013 # ref :

        from Tkinter import * from random import randrange
      • entropie_melangeplugin-autotooltip__default plugin-autotooltip_bigEntropie de mélange pour un gaz ou liquide idéal

        #! /usr/bin/env python # -*- coding: utf-8 -*- “”“ représentation graphique de l'entropie de mélange d'un système idéal ”“”

        import numpy as np # voir
      • epidemie_coronavirusplugin-autotooltip__default plugin-autotooltip_bigÉpidémie du coronavirus COVID-19

        Références :

        * Coronavirus disease 2019 * Maladie à coronavirus 2019 * Coronavirus COVID-19 Global Cases by Johns Hopkins CSSE * Coronavirus (COVID-19) Mortality Rate * data :

        Programmes de représentations

        FIXME

        Quelques simulations SEIR effectuées par des scientifiques :

        * Marius Gilbert (ULB/FNRS, Spatial Epidemiology lab (SpELL),
      • factorielle-2plugin-autotooltip__default plugin-autotooltip_bigFactorielle : un premier programme

        Voici un embryon non fonctionnel de programme. Il y manque des éléments (à la place des “???”)

        #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calcul de la factorielle d'un nombre Référence : http://fr.wikipedia.org/wiki/Factorielle """ # on demande le nombre : print("Calcul de la factorielle de n") chainelue = input("Que vaut n ? ") n = int(chainelue) print(n)

        # structure de répétition pour appliquer la définition de la factorielle reponse=1 # la répon…
      • factorielle-3plugin-autotooltip__default plugin-autotooltip_bigFactorielle : une fonction en Python

        Voici une version avec la fonction factorielle()

        #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calcul de la factorielle d'un nombre Référence : http://fr.wikipedia.org/wiki/Factorielle """ def factorielle(arg_n): """ structure de répétition pour appliquer la définition de la factorielle """ reponse = 1 # la réponse sera dans la variable reponse i = 1 # on va commencer par 1 while i <= arg_n: …
      • factorielle-4plugin-autotooltip__default plugin-autotooltip_bigFactorielle : travaux additionnels

        Idées d'exercices complémentaires, d'applications.

        Utilisation d'un dictionnaire

        Il peut être intéressant de précalculer des factorielles qui seront mémorisées dans un dictionnaire.

        Comparaison avec l'approximation de Stirling
      • factorielleplugin-autotooltip__default plugin-autotooltip_bigCalcul de factorielles

        La factorielle d'un nombre naturel n est le produit des nombres entiers strictement positifs inférieurs ou égaux à n. Elle est notée n!. Pour n=0, on a 0!=1, ensuite 1!=1, 2!=2, 3!=6, 4!=24,...

        Un premier (mauvais) programme

        Regardez, et essayez
      • fit_modele_einsteinplugin-autotooltip__default plugin-autotooltip_bigOptimisation de la température caractéristique du diamant suivant le modèle d'Einstein

        Ce modèle prévoie la dépendance à la température de la capacité calorifique d’un solide cristallin.

        La détermination de la température caractéristique nécessite de
      • fizz_buzzplugin-autotooltip__default plugin-autotooltip_bigFizz buzz

        Fizz buzz est un jeu de comptage et de divisibilité conçu pour des enfants. Les joueurs comptent à tour de rôle en incrémentant, partant de 1, et remplaçant chaque nombre divisible par 3 par le mot “fizz”, et chaque mot divisible par 5 par le mot
      • game_of_life_conway-2012plugin-autotooltip__default plugin-autotooltip_bigJeu de la vie de Conway

        Game of Life with Python

        #!/usr/bin/env python # -*- coding: utf-8 -*- “”“A minimal implementation of Conway's Game of Life.

        source : modified by par Jérémie Knoops, BA2 chimie UMONS, 2011-2012 cf.
      • gaz_parfait_2011plugin-autotooltip__default plugin-autotooltip_bigLoi des gaz parfaits

        #!/usr/bin/env python # -*- coding: utf-8 -*- # Programme de calculs sur la loi des gaz parfaits # GD, Ba2 chimie 2010-2011 from Tkinter import * #permet l'apparition de l'interface graphique
      • glossaire_chimieplugin-autotooltip__default plugin-autotooltip_bigGlossaire de chimie

        Cf. le glossaire de chimie

        #!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Utilisation du glossaire https://dvillers.umons.ac.be/wiki/teaching:glossaire-chimie Le code dokuwiki source doit être sauvegardé dans un fichier glossaire-dokuwiki.txt

        Programme de base à modifier/compléter. """ from pathlib import Path home = str(Path.home())

        # fichier d'entrée with open(home + "/tempo/glossaire-dokuwiki.txt", "r") as ifile: lines = ifile.readlines() ifile.close() …
      • grille_configurations_melange_binaire_2013plugin-autotooltip__default plugin-autotooltip_bigCréation d'une grille et de configurations d'un système binaire modélisé

        #!/usr/bin/env python # -*- coding: utf-8 -*- # travail de ML et MP, ba2 chimie 2012-2013 # Création d'une grille et de configurations d'un système binaire modélisé
      • jupyterplugin-autotooltip__default plugin-autotooltip_bigJupyter, IPython Notebooks et JupyterLab

        * Jupyter a succédé à IPython Notebook * Jupyter est installé par défaut avec la distribution python Anaconda. C'est la manière la plus adéquate d'utiliser Jupyter. * Sinon, on peut utiliser facilement les notebooks Jupyter sur la plateforme
      • koch_snowflakeplugin-autotooltip__default plugin-autotooltip_bigFlocon de Koch

        Courbe fractale créée suivant un principe de récursivité, en utilisant la librairie turtle

        #!/usr/bin/env python # -*- coding: iso-8859-1 -*-

        # exemple de courbe fractale (Koch) # cf. http://fr.wikipedia.org/wiki/Flocon_de_von_Koch # et http://en.wikipedia.org/wiki/Koch_snowflake # ce programme est basé sur un principe de récursivité # (une fonction qui s'appelle elle-même)

        from turtle import * # module turtle. Doc : http://docs.python.org/library/turtle.html from time impo…
      • lennard-jonesplugin-autotooltip__default plugin-autotooltip_bigReprésentation du potentiel de Lennard-Jones

        L'utilisation de fonctions en python permet de nombreuses applications par la création de graphiques. En utilisant la “bibliothèque matplotlib/pylab”, vous pourrez donc aisément créer des graphes de fonction.$V_{LJ} = 4\varepsilon \left[ \left(\frac{\sigma}{r}\right)^{12} - \left(\frac{\sigma}{r}\right)^{6} \right] = \varepsilon \left[ \left(\frac{r_{m}}{r}\right)^{12} - 2\left(\frac{r_{m}}{r}\right)^{6} \right]$$r_{m} = 2^{1/6} \sigma$$U_{tot} = \fr…
      • math_nombresplugin-autotooltip__default plugin-autotooltip_bigMathématiques et nombres

        Quelques programmes et algorithmes reliés aux mathématiques et aux nombres.

        * Théorie des nombres * Nombre_remarquable * ...

        Calculs en précision arbitraire

        * 1/9² = 0.0123456790123456790123456790123456790123456790123457... * 1/99² = 0.0001020304050607080910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455565758596061626364656667686970717273747576777879808182838485868788899091929394959697990001020304050607080910111$…
      • matplotlib_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Matplotlib, une librairie pour réaliser des graphiques 2D

        Matplotlib est une bibliothèque très puissante du langage de programmation Python destinée à tracer et visualiser des données sous formes de graphiques. Elle est souvent combinée avec les bibliothèques python de calcul scientifique :
      • matricesplugin-autotooltip__default plugin-autotooltip_bigManipulations de matrices

        Les matrices sont des tableaux de nombres à deux dimensions. On peut utiliser des listes de lignes, qui sont elles-mêmes des listes d'éléments de la ligne, pour représenter une matrice. On aura donc des listes de listes.
      • maxwell-boltzmannplugin-autotooltip__default plugin-autotooltip_bigReprésentation de la distribution de vitesse de Maxwell-Boltzmann

        Pour la théorie, cf. le cours de physico-chimie ou la page Wikipédia sur la distribution de vitesse de Maxwell-Boltzmann

        Sans NumPy

        #! /usr/bin/env python # -*- coding: utf-8 -*- “”“ NumPy/Matplotib : representation de la distribution de vitesses de Maxwell-Boltzmann version SANS utilisation de NumPy cf cours et
      • nimplugin-autotooltip__default plugin-autotooltip_bigJeux de Nim

        * fr:Jeux_de_Nim * Nim: A Game Playing Program Seymour Papert, MIT Artificial Intelligence Memo No. 254, 1970 (from The Collected Writings of Seymour Papert) * version de l'article sur archive.org, version texte disponible

        FIXME : codes python...

        Références

        * évolution du jeu, javascript en ligne * vidéo sur l'élaboration d'un programme en python
      • notions_avanceesplugin-autotooltip__default plugin-autotooltip_bigNotions avancées

        En construction. Les liens sont juste donnés. Une introduction et un exemple devrait être proposé pour chaque rubrique, et le nombre de ces rubriques augmenté.

        Itérateurs

        Générateurs et "yield"

        * * * *
      • notions_fondamentalesplugin-autotooltip__default plugin-autotooltip_bigNotions fondamentales

        Aide mémoire synthétique sur le langage Python. Les différences importantes entre la branche 2 et la branche 3 seront commentées. La différence la plus fréquente est le passage de print à print() !

        Règles de base

        Ces règles peuvent être testées via le mode interactif de Python (en utilisant la fenêtre
      • numpy_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de NumPy

        NumPy est une extension du langage de programmation Python, destinée à manipuler des matrices ou tableaux multidimensionnels ainsi que des fonctions mathématiques opérant sur ces tableaux.

        Numpy permet la manipulations des vecteurs, matrices et polynômes.
      • open_chemical_databasesplugin-autotooltip__default plugin-autotooltip_bigBases de données libres en chimie

        Références

        Databases, databank

        * Chemical databases +... * * * * *

        Données de wikipedia

        * Chembox template * * *
      • openbabel_jmolplugin-autotooltip__default plugin-autotooltip_bigOpenBabel et Jmol

        OpenBabel

        OpenBabel est un ensemble de programme permettant de manipuler et convertir les fichiers de description de molécules dans différents formats.

        * Site officiel : * Interfaçage en Python :

        Pour utiliser OpenBabel en python, il faut installer au préalable ces outils. Sous Linux (Debian, Ubuntu,
      • osm_interrogationplugin-autotooltip__default plugin-autotooltip_bigInterrogation de la base de données géolocalisées OpenStreetMap

        API OSM en Python

        * Application Programming Interface, en Python

        Installation via pip :

        pip(3) install osmapi

        Exemple de code

        Recherche de débit de boissons (“pub”) via la base de données d'OpenStreetMap.

        #!/usr/bin/python # -*- coding: UTF-8 -*-
      • pandasplugin-autotooltip__default plugin-autotooltip_bigPandas

        Module pour l'analyse de données, pouvant se substituer à l'utilisation d'un tableur. Une différence fondamentale de la librairie pandas avec NumPy, c'est que les tableaux NumPy (NumPy arrays) ont le même type (dtype) pour le tableau entier, tandis que les tableaux pandas (pandas DataFrames) sont caractérisés par un type unique (dtype) par colonne.$X$$x$$P(x)$$X$$x$$x_1, x_2, x_3, \ldots$$X$$P(x_i)$$X$$x$$P(x)$$x$$x+dx$$P(x)$$x$$P(x) dx$$P(x) dx = P(x \le X < x+dx)$$P(x_i) \ge 0$$x_i$$P(…
      • parsing_chemical_formulaplugin-autotooltip__default plugin-autotooltip_bigDécomposition de formules chimiques

        Analyse de chaînes de caractères formées par la concaténation de symboles d'éléments chimiques.

        Problème de base

        * Décomposer une chaîne de caractères formée par des symboles chimiques répétés : CaClCNOSbInAsFICl
      • pavage_penrose_2013plugin-autotooltip__default plugin-autotooltip_bigPavage de Penrose

        #!/usr/bin/env python # -*- coding: utf-8 -*- # réference : # version un peu aménagée du travail de EC et LP, ba2 chimie 2012-2013

        import math import cmath import cairo

        # definir le nombre d'or goldenRatio = (1 + math.sqrt(5)) / 2
      • periodical_table_electronegativityplugin-autotooltip__default plugin-autotooltip_bigVue 3D de l'électronégativité

        #!/usr/bin/env python # -*- coding: utf-8 -*- """ Periodical table 3D view of electronegativity """

        from mpl_toolkits.mplot3d import Axes3D import matplotlib.pyplot as plt import numpy as np

        data = np.array([ [2.2,1,0.9,0.8,0.8,0.8,0.7], [0,1.6,1.3,1,1,0.9,0.9], [0,0,0,1.4,1.2,1.3,0], [0,0,0,1.5,1.3,1.3,0], [0,0,0,1.6,1.6,1.5,0], [0,0,0,1.6,2.2,2.4,0], [0,0,0,1.6,1.9,1.9,0], [0,0,0,1.8,2.2,2.2,0], [0,0,0,1.9,2.3,2.2,0], [0,0,0,1.8,2.2,2.3,0], [0,0,0,1.9,1.9,2.5…
      • ph-3dplugin-autotooltip__default plugin-autotooltip_bigReprésentation 3D du pH

        Cas d'un acide en fonction d'un ajout de base et d'une dilution globale : cf. cet article

        #! /usr/bin/env python # -*- coding: utf-8 -*- “”“ Use of numpy polynomes to compute pH of weak acid and strong base
      • ph_acides_bases_2013plugin-autotooltip__default plugin-autotooltip_bigReprésentation de pH d'acides et de bases

        Pour les acides :

        #!/usr/bin/env python # -*- coding: utf-8 -*- # travail de QD et TB, ba2 chimie 2012-2013

        import Tkinter as tk from numpy import * import matplotlib.pyplot as plt
      • ph_courbe_titrage_2011plugin-autotooltip__default plugin-autotooltip_bigpH et courbe de titrage

        #!/usr/bin/env python # -*- coding: utf-8 -*- # Programme de calculs de pH et de courbes de titrages # AD & BW, Ba2 chimie 2010-2011

        from math import * from Tkinter import * import matplotlib.pyplot as plt import numpy as np
      • piegesplugin-autotooltip__default plugin-autotooltip_bigPièges à éviter

        Quelques pièges à éviter !

        Type de données

        * travailler avec des nombres et ne pas mettre le point décimal s'ils ont une valeur entière les laissera dans le type 'int'. * Ne pas confondre une liste contenant un nombre, et ce nombre.
      • plot_sinus_cosinusplugin-autotooltip__default plugin-autotooltip_bigGraphe simple de sinus et cosinus

        On montre en détail comment réaliser une représentation graphique simple des fonctions sinus et cosinus. Au départ le graphique utilisera les réglages par défaut et la figure sera ensuite améliorée pas à pas en commentant les instructions matplotlib utilisées.
      • plotly_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Plotly

        Plotly ( est une société développant des outils analytiques et de visualisation. La librairie python Plotly permet de créer des graphes dans l'environnement de Jupyter. FIXME : à compléter

        Références

        * plot.ly, le site officiel
      • polynomes-2plugin-autotooltip__default plugin-autotooltip_bigPolynômes : évaluation

        #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynômes """

        x = 3. # variable en laquelle on veut évaluer le polynôme a = [2.5, 6., 1.2, 3, 5] # la liste des coefficients, par ordre croissant n = len(a) - 1 # l'ordre du polynôme print(x,a,n) p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes

        print(p)
      • polynomes-3plugin-autotooltip__default plugin-autotooltip_bigPolynômes : fonction pour évaluer

        #!/usr/bin/python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """

        def polyeval(x,a): """ Fonction s'occupant uniquement de l'évaluation du polynome fonction de x avec les coefficients dans la liste a """ n = len(a) - 1 p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes return p

        # premier exemple d'utilisation …
      • polynomes-4plugin-autotooltip__default plugin-autotooltip_bigPolynômes : structure de répétition (boucle for)

        #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """

        def polyeval(x,a): """ Fonction s'occupant uniquement de l'évaluation du polynome fonction de x avec les coefficients dans la liste a """ n = len(a) - 1 p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes return p

        varx = 0.5 varc…
      • polynomes-5plugin-autotooltip__default plugin-autotooltip_bigPolynômes : boucle for, fonction mathématique

        #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """ from math import *

        def polyeval(x,a): """ Fonction s'occupant uniquement de l'évaluation du polynome fonction de x avec les coefficients dans la liste a """ n = len(a)-1 p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes return p …
      • polynomes-6plugin-autotooltip__default plugin-autotooltip_bigPolynômes : la méthode de Horner

        432 Cela revient à effectuer les opérations successives suivantes :

        * prendre le coefficient de x4 * multiplier par x * ajouter le coefficient de x3 * multiplier par x * ajouter le coefficient de x2 *
      • polynomes-7-contrib1plugin-autotooltip__default plugin-autotooltip_bigPolynômes : version alternative pour l'addition

        Proposition de BF, étudiant ba2 2012-2013. Le principe est d'additionner les termes tant qu'on est en dessous du degré maximum du polynôme de degré minimum ! et en complétant ensuite par les coefficients de degré supérieur du polynôme de degré maximum
      • polynomes-7plugin-autotooltip__default plugin-autotooltip_bigPolynômes : comment les multiplier par un scalaire et les additionner

        #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes + fonction de multiplication d'un polynôme pas un scalaire + fonction d'addition de deux polynômes """ from math import *

        def polyeval(x,a): """ application de l'agorithme de Horner cf. http://fr.wikipedia.org/wiki/M%C3%A9thode_de_Ruffini-Horner """ n = len(a) - 1 # n = ordre du polynôme p =0. for…
      • polynomes-8plugin-autotooltip__default plugin-autotooltip_bigPolynômes : graphes de fonctions polynomiales

        #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """ from math import * from pylab import * # librairies de graphiques (matplotlib)

        def polyeval(x,a): """ application de l'agorithme de Horner cf. http://fr.wikipedia.org/wiki/M%C3%A9thode_de_Ruffini-Horner """ n = len(a)-1 # n = ordre du polynome p = 0. for i in range(n,-1,-1): p = p*x + a[i] return p

        def…
      • polynomes-9plugin-autotooltip__default plugin-autotooltip_bigPolynômes : graphe multiple fonctions polynomiales

        # -*- coding: utf-8 -*- """ graphe multiple de polynômes de Tchebyshev cf. http://fr.wikipedia.org/wiki/Polyn%C3%B4me_de_Tchebychev """

        from pylab import * # librairie graphique (Matplotlib)

        def polyeval(x,a): """ application de l'agorithme de Horner cf. http://fr.wikipedia.org/wiki/M%C3%A9thode_de_Ruffini-Horner """ n = len(a)-1 # n = ordre du polynôme p = 0. for i in range(n,-1,-1): p = p*x + a[i] …
      • polynomes-10plugin-autotooltip__default plugin-autotooltip_bigPolynômes : fonctionnalités supplémentaires

        Voici quelques fonctions utiles pour manipuler les polynômes :

        Dérivation

        Proposé et testé par RL, étudiant ba2 2012-2013.

        #!/usr/bin/env python # -*- coding: utf-8 -*- def polyderiv(a): """ dérivation d'un polynôme """ b = a[:] #copie de la liste des coefficients du polynôme de départ n = len(b) -1 #ordre du polynôme for i in range (n+1): b[i] = b[i] * i #on redéfinit chaque coefficient i de la liste par ce…
      • polynomes-11plugin-autotooltip__default plugin-autotooltip_bigGraphe d'une famille de polynômes orthogonaux

        Voici un programme permettant de visualiser les premiers polynômes orthogonaux de Tchebyshev :

        #!/usr/bin/env python # -*- coding: utf-8 -*- """ graphes de Polynomes de Chebyschev """

        from math import * from pylab import *

        def polyeval(x,a): """ application de l'algorithme de Horner cf. http://fr.wikipedia.org/wiki/M%C3%A9thode_de_Ruffini-Horner """ n = len(a)-1 # n = ordre du polynome p = 0. for i in range(n,-1,-1): …
      • polynomes-12plugin-autotooltip__default plugin-autotooltip_bigUtilisation de polynômes orthogonaux avec NumPy

        Voici un programme permettant d'obtenir le même graphe que celui obtenu précédemment, en utilisant les modules spécifiques de NumPy. Cet exemple montre tout l'intérêt d'utiliser des modules pré-existants. Le programme est réduit à 3 lignes pour l'importation, 4 pour la création des graphes et 4 pour commander la représentation.
      • polynomesplugin-autotooltip__default plugin-autotooltip_bigPolynômes

        Travail avec des polynômes :

        * un polynôme est une fonction * un polynôme est caractérisé de manière univoque par ses coefficients * le degré d'un polynôme est l'exposant qui caractérise le terme de puissance la plus élevée
      • ppooplugin-autotooltip__default plugin-autotooltip_bigProgrammation Python Orientée Objet

        FIXME : en construction

        Concepts utilisés

        * Un objet : c'est... n'importe quoi, qui peut être codé. En Python, tout est objet ! * Une classe est une description générique d'un type d'objet, incluant les données et les méthodes qui le caractérisent
      • presentation_principesplugin-autotooltip__default plugin-autotooltip_big* Qu'est-ce qu'un langage de programmation ? * Compilation ou interprétation, ou... ?

        * Décrire des instructions dans un langage compréhensible par un être humain, mais transformable en d'autres instructions compréhensibles par l'ordinateur (langage machine)
      • pressions_partielles_systemes_non_ideauxplugin-autotooltip__default plugin-autotooltip_bigGraphiques des pressions partielles de systèmes non-idéaux

        #!/usr/bin/env python # -*- coding: utf-8 -*- “”“ Graphiques des pressions partielles de systèmes non-idéaux Basé sur le travail de ML et VM, ba2 chimie 2013-2014
      • print_formatplugin-autotooltip__default plugin-autotooltip_bigImpressions avec la méthode .print()

        FIXME : à compléter par les règles essentielles et quelques exemples

        Références

        * * * *
      • pygal_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Pygal

        FIXME

        Références

        * * Why use pygal?
      • pylab_simpleplugin-autotooltip__default plugin-autotooltip_bigPylab

        Pylab permet de combiner simplement Matplotlib, NumPy et SciPy, en utilisant une directive d'importation supprimant l'usage de tous les namespaces des librairies sous-jacentes :

        from pylab import *

        Exemple

        Version “Pylab” du code utilisé pour la
      • random_walk_2d-simpleplugin-autotooltip__default plugin-autotooltip_bigMarche aléatoire 2D simple

        Dans les modèles les plus simples, on considère un polymère comme un ensemble de segments faisant entre eux un angle quelconque (freely jointed chain). Ce problème est aussi dénommé “marche aléatoire” (random walk) en mathématique ou physique. Il peut aussi rendre compte d'autres phénomènes tel que celui de la diffusion. Après simulation, vous comprendrez pourquoi on appelle
      • rdkitplugin-autotooltip__default plugin-autotooltip_bigRDKit

        * * *
      • recherchesplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes de recherche

        Classiquement, pour des données structurées en listes, arbres, un algorithme de recherche va selon un critère donné (une valeur par exemple) retourner un ensemble d'occurrences (toutes, plusieurs, une seule,...).

        Recherche séquentielle
      • regression_lineaire_2013plugin-autotooltip__default plugin-autotooltip_bigRégression linéaire

        Entrée de couples, calcul et affichage de la droite de moindres carrés

        #!/usr/bin/env python # -*- coding: utf-8 -*- # version un peu aménagée du travail de BD et EH, ba2 chimie 2012-2013

        import matplotlib.pyplot as plt import pylab import numpy
      • representation_molecules_2013plugin-autotooltip__default plugin-autotooltip_bigReprésentation de molécules

        Page à actualiser...

        Certaines fonctions de ce programme nécessite des fichiers de données : [base.csv] et [bdd.csv] #!/usr/bin/env python # -*- coding: UTF-8 -*- # travail de RL, ba2 chimie 2012-2013
      • scikit_learnplugin-autotooltip__default plugin-autotooltip_bigScikit-learn

        * *

        FIXME : ajouter des exemples avec analyse de textes contenant des termes scientifiques, des noms de substances chimiques,...

        * Scikit-chem, simple cheminformatics for Python * MolMiner, for extracting compounds from scientific literature *
      • scipy_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de SciPy

        La librairie SciPy ajoute à NumPy des fonctionnalités mathématiques.

        Directive d'importation

        * Méthode standard : import scipy as sp

        * Importation par sous-modules (cf le site de Scipy) : from scipy import optimize from scipy import interpolate from scipy import integrate ...
      • slicesplugin-autotooltip__default plugin-autotooltip_bigSlices sur les séquences

        L'utilisation des “slices” ou du “slicing” sur les listes, ou sur tout objet en séquence (tuple, chaîne de caractères, ...) permet de “découper” des sous-listes. Si la séquence s'appelle sequence_name, la syntaxe du slice est : sequence_name[start:stop:step] où start est l'indice du premier élément (par défaut 0), stop est l'indice du premier élément NON REPRIS (par défaut len(seq
      • solubilite_ph_tplugin-autotooltip__default plugin-autotooltip_bigSolubilité en fonction du pH et de la température

        Interface en ligne de commande et graphiques matplotlib

        Nécessite [ce fichier de données] (à décompresser).

        #!/usr/bin/env python # -*- coding: utf-8 -*- “”“
      • solvents_data_classplugin-autotooltip__default plugin-autotooltip_bigUtilisation d'une "classe" pour des données de solvants chimiques

        On peut utiliser la structure de classe pour créer une “table” de données sur des solvants. Il est alors possible d'effectuer des traitements de tris, sélection, impression...
      • startplugin-autotooltip__default plugin-autotooltip_bigProgrammation appliquée à la chimie

        Le cours “Programmation appliquée à la chimie” de bachelier en sciences chimiques (15 H cours et 15 H exercices, bloc2) utilise deux supports :

        * Principalement, le présent wiki pour ses avantages techniques (coloration et indentation du code, recherche dans les pages, historique des modifications,
      • suite_de_fibonacci-2plugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : un premier programme

        Voici un embryon non fonctionnel de programme. Il y manque alors des éléments (à la place des “???”)

        #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : http://fr.wikipedia.org/wiki/Suite_de_Fibonacci """ # élément d'indice 0 i = 0 a = 0 print(i,a) # élément d'indice 1 i = 1 b = 1 print(i,b)

        # structure de répétition pour appliquer la règle de récurrence max = 100 # indice du dernier …
      • suite_de_fibonacci-3plugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : écriture de fonctions

        Voici la structure que doit avoir un programme pour lequel le calcul de l'élément d'indice n de la suite de Fibonacci est encapsulé dans une fonction :

        #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : http://fr.wikipedia.org/wiki/Suite_de_Fibonacci """ def fibonacci_item(n): """ Renvoie l'élément d'indice n de la suite de Fibonacci """ ...

        if __name__ == '__main__'…
      • suite_de_fibonacci-4plugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : encore un algorithme

        Voici le programme complété pour la technique récursive :

        #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : http://fr.wikipedia.org/wiki/Suite_de_Fibonacci Application de la définition par récursivité. """ def fibonacci_item_recursive(n): """ Renvoie l'élément d'indice n de la suite de Fibonacci """ if n == 0: return 0 elif n == 1: return 1 ret…
      • suite_de_fibonacci-5plugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : quel est le meilleur algorithme ?

        Comparer les temps avec timeit

        La librairie timeit mesure les temps d'exécution en évitant des biais tels que l'usage concomitant d'autres ressources.

        #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : http://fr.wikipedia.org/wiki/Suite_de_Fibonacci Comparaison de différentes fonctions avec Timeit http://docs.python.org/2/library/timeit.html http://www.diveintopython.net…
      • suite_de_fibonacciplugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci

        La suite de Fibonacci est une suite d'entiers dans laquelle chaque terme est la somme des deux termes qui le précèdent. Elle commence généralement par les termes 0 et 1 (parfois 1 et 1) et ses premiers termes sont : 0, 1, 1, 2, 3, 5, 8, 13, 21, etc. (reference
      • t-testplugin-autotooltip__default plugin-autotooltip_bigTest de Student

        Le test de Student (t-test) teste statistiquement l’hypothèse d’égalité de l'espérance de deux variables aléatoires suivant une loi normale et de variance inconnue.

        Références

        * (des exemples simples) * Documentation Python sur stats de scipy * 1-sample t-test * Unpaired t-test * Paired t-test
      • tableau_periodique_2011plugin-autotooltip__default plugin-autotooltip_bigTableau périodique

        #!/usr/bin/env python # -*- coding: utf-8 -*- # Programme sur le tableau périodique # MJ, Ba2 chimie 2010-2011

        from Tkinter import * from element_liste import * #sert à importer la liste présente dans l'autre fichier
      • tableau_periodique_2013plugin-autotooltip__default plugin-autotooltip_bigTableau périodique

        Tableau avec éléments cliquables pour obtenir les information. Nécessite [ce fichier de données].

        #!/usr/bin/env python # -*- coding: utf-8 -*- # version un peu aménagée du travail de TD et SD, ba2 chimie 2012-2013 def elem(x): # print type(x),x # pour montrer que x est une chaîne de caractères element=Tk() element.title("Propriété du"+ x ) elembox=Listbox(element,height=32,width=40,fg="#070942") elembox.pack() for item in table[int(x)]: …
      • testjsplugin-autotooltip__default plugin-autotooltip_bigTest Javascript + dokuwiki + DataCamp-light

      • tkinter_gui_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases d'un interface graphique avec Tkinter

        Quelques références de base pour utiliser Tkinter

        * Documentation officielle : * Les interfaces graphiques TK * tkinter — interface Python à Tcl/Tk, reprenant quelques références recommandées * Python 3 avec Tk intègre également les extensions
      • trisplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes de tri

        Un algorithme de tri est, en informatique ou en mathématiques, un algorithme qui permet d'organiser une collection d'objets selon un ordre déterminé (Référence wikipedia).

        Les tris sont intéressants du point de vue de l'apprentissage de l'algorithmique.
      • trucs_astucesplugin-autotooltip__default plugin-autotooltip_bigTrucs et astuces

        * Fusionner deux dictionnaires * * ...
    • agendaplugin-autotooltip__default plugin-autotooltip_bigAgenda

      Activités diverses liées à l'enseignement directement ou indirectement, par ordre chronologique

      2018-10-20 : Playful Science 12

      * Pour mémoire, le festival se déroulera dans le bâtiment S de l’ULB, avenue Jeanne, 44 - 1050 – Bruxelles, le samedi 20 octobre 2018 de 9 h à 17 h.
    • aluminiumplugin-autotooltip__default plugin-autotooltip_bigAluminimum

      FIXME : à compléter

      Media

      * Pourquoi s’inquiéter de l’aluminium dans les déodorants et pas dans les vaccins ? * Le carburant du futur sera-t-il une poudre métallique ?, CNRS Le journal, 12/07/2019 * Aluminium et mercure * * *
    • applications_diversesplugin-autotooltip__default plugin-autotooltip_bigApplications intéressantes

      * Zeer ou le Frigo du Désert * Efficacité énergétique des transports (vivant, machines,...)
    • argentplugin-autotooltip__default plugin-autotooltip_bigArgent

      Vidéos :

      * *
    • arsenicplugin-autotooltip__default plugin-autotooltip_bigArsenic

      FIXME

      * fr:Arsenic & Arsenic

      L'arsenic a été fortement utilisé sous forme de sels comme pesticide en agriculture (Arséniate de plomb. En 1919, rien que la production mondiale d'arsenic était d'environ 20 000 tonnes ! (Source : Minerals Yearbook 1920, p60)
    • articles_didactique_chimieplugin-autotooltip__default plugin-autotooltip_bigSélection d'articles en didactique de la chimie

      Liens rapides :

      * : numéro courant de Journal of Chemical Education où vous avez la possibilité de consulter les résumés. Si vous souhaitez recevoir la table des matières à chaque nouveau numéro, il vous suffit de prendre l'option
    • azoteplugin-autotooltip__default plugin-autotooltip_bigAzote

      FIXME

      Agriculture :

      * Fixation biologique du diazote * L'azote est un des éléments majeurs nécessaires à la croissance des plantes. Sa présence est nécessaire mais son excès est préjudiciable pour l'environnement (nitrates). Des normes existent, et les agriculteurs doivent effectuer des apports précis (compost, fumier, engrais
    • biblio-10.1016-j.chb.2015.08.038plugin-autotooltip__default plugin-autotooltip_bigL'efficacité des exemples résolus par rapport aux exemples erronés, à la résolution de problèmes avec tutorat et à la résolution de problèmes dans des environnements d'apprentissage basés sur ordinateur

      The efficiency of worked examples compared to erroneous examples, tutored problem solving, and problem solving in computer-based learning environments Bruce M. McLaren, Tamara van Gog, Craig Ganoe, Michael Karabinos, David Yaron, Computers in Human Behavior Volume 55, Part A, February 2016, Page…
    • biblio-10.1021-acs.chemrev.8b00020plugin-autotooltip__default plugin-autotooltip_bigRecherche sur l'enseignement de la chimie - De l'empirisme personnel aux données probantes, à la théorie et à la pratique éclairée

      FIXME ; compléter et ajouter à biblio-didactique-chimie

      Voir aussi (accès restreint) :

      * two-tier multiple choice diagnostic instruments (questions à choix multiple avec justification)
    • biblio-10.1021-acs.jchemed.5b00109plugin-autotooltip__default plugin-autotooltip_big5 choses que les chimistes devraient savoir à propos de la littérature de la recherche en éducation

      Article Five Things Chemists (and Other Science Faculty) Should Know about the Education Research Literature S. Seethaler, J. Chem. Educ., 2016, 93 (1), pp 9–12 DOI: 10.1021/acs.jchemed.5b00109 résumé de M.A. 2016-2017

      Introduction

      De nombreuses études empiriques démontrent la valeur ajoutée de l’apprentissage actif, c’est-à-dire une approche constructive du savoir. Si l’enseignant suit cette…
    • biblio-10.1021-acs.jchemed.5b00164plugin-autotooltip__default plugin-autotooltip_bigExploration du contexte quotidien des éléments chimiques : Découvrir les éléments des composants automobiles

      Article Exploring the Everyday Context of Chemical Elements: Discovering the Elements of Car Components Antonio Joaquín Franco-Mariscal, J. Chem. Educ., 2015, 92 (10), pp 1672–1677 DOI: 10.1021/acs.jchemed.5b00164 résumé de L.R. 2016-2017
    • biblio-10.1021-acs.jchemed.5b00190plugin-autotooltip__default plugin-autotooltip_bigVariations sur la démonstration de la "bouteille bleue" avec des aliments contenant un colorant bleu

      Variations on the “Blue-Bottle” Demonstration Using Food Items That Contain FD&C Blue #1 Felicia A. Staiger, Joshua P. Peterson, and Dean J. Campbell, J. Chem. Educ., 2015, 92 (10), pp 1684–1686 DOI: 10.1021/acs.jchemed.5b00190 résumé de C.D. 2015-2016
    • biblio-10.1021-acs.jchemed.5b00203plugin-autotooltip__default plugin-autotooltip_bigPourquoi demander pourquoi ?

      Article : Why Ask Why? Melanie M. Cooper, J. Chem. Educ., 2015, 92 (8), pp 1273–1279 DOI: 10.1021/acs.jchemed.5b00203 résumé de C.M. 2015-20162015-2016

      Sujet

      Dans cet article, l’auteur dit qu’il est important d’aider les étudiants à construire des explications mécanistiques et causales des phénomènes, c’est-à-dire, aider les étudiants à utiliser leur compréhension des interactions au niveau moléculaire afin d’expliquer et prédire les événements se produisant au …
    • biblio-10.1021-acs.jchemed.5b00592plugin-autotooltip__default plugin-autotooltip_bigExamen de l'efficacité d'un format d'apprentissage en "classe inversée" semi-stimulé dans une séquence de chimie générale

      Article Examining the Effectiveness of a Semi-Self-Paced Flipped Learning Format in a College General Chemistry Sequence Lisa Hibbard, Shannon Sung, and Breché Wells, J. Chem. Educ., 2016, 93 (1), pp 24–30 DOI: 10.1021/acs.jchemed.5b00592 résumé de H.D. 2016-2017
    • biblio-10.1021-acs.jchemed.5b00635plugin-autotooltip__default plugin-autotooltip_bigÉlaboration et mise en œuvre d'une expérience simple et engageante de neutralisation des pluies acides et d'une vidéo d'animation correspondante pour les étudiants en chimie

      Development and Implementation of a Simple, Engaging Acid Rain Neutralization Experiment and Corresponding Animated Instructional Video for Introductory Chemistry Students Danielle Rand, Craig J. Yennie, Patrick Lynch, Gregory Lowry, James Budarz, Wenlei Zhu, and Li-Qiong Wang, J. Chem. Educ., 2016, 93 (4), pp 722–728 DOI: …
    • biblio-10.1021-acs.jchemed.5b00729plugin-autotooltip__default plugin-autotooltip_bigConstruction et caractérisation d'un colorimètre compacte, portable, et à bas coût pour le laboratoire de chimie

      Article Construction and Characterization of a Compact, Portable, Low-Cost Colorimeter for the Chemistry Lab Carrie M. Clippard, William Hughes, Balwant S. Chohan, Danny G. Sykes, J. Chem. Educ., 2016, 93 (7), pp 1241–1248 DOI: 10.1021/acs.jchemed.5b00729 résumé de A.H. 2016-2017
    • biblio-10.1021-acs.jchemed.5b00958plugin-autotooltip__default plugin-autotooltip_bigÉtude de l'équilibre d’une réaction chimique entre les ions ferriques et les ions iodures en solution aqueuse en utilisant une approche simple et peu coûteuse

      Article Studying Equilibrium in the Chemical Reaction between Ferric and Iodide Ions in Solution Using a Simple and Inexpensive Approach Pavel Anatolyevich Nikolaychuk and Alyona Olegovna Kuvaeva, J. Chem. Educ., 2016, 93 (7), pp 1267–1269 DOI: 10.1021/acs.jchemed.5b00958
    • biblio-10.1021-acs.jchemed.5b01010plugin-autotooltip__default plugin-autotooltip_bigEfficacité des leçons basées sur la recherche utilisant les modèles au niveau particulaire pour développer la compréhension conceptuelle de la Stœchiométrie par les élèves du secondaire

      Article Effectiveness of Inquiry-Based Lessons Using Particulate Level Models To Develop High School Students’ Understanding of Conceptual Stoichiometry, Stephanie Kimberlin and Ellen Yezierski, J. Chem. Educ., 2016, 93 (6), pp 1002–1009 DOI: 10.1021/acs.jchemed.5b01010 résumé de A.H. 2016-2017
    • biblio-10.1021-acs.jchemed.5b01037plugin-autotooltip__default plugin-autotooltip_bigIntroduction de méthodologies basées sur des enquêtes lors de la formation initiale d'enseignants du secondaire en utilisant un problème ouvert sur les transformations chimiques

      Article Introducing Inquiry-Based Methodologies during Initial Secondary Education Teacher Training Using an Open-Ended Problem about Chemical Change, Iñigo Rodríguez-Arteche and M. Mercedes Martínez-Aznar, J. Chem. Educ., 2016, 93 (9), pp 1528–1535 DOI: 10.1021/acs.jchemed.5b01037 résumé de E.M. 2016-2017
    • biblio-10.1021-acs.jchemed.6b00034plugin-autotooltip__default plugin-autotooltip_bigUn aperçu de la façon dont les élèves apprennent la différence entre un acide faible et un acide fort à partir de tutoriels animés utilisant des visualisations

      Article Insights into How Students Learn the Difference between a Weak Acid and a Strong Acid from Cartoon Tutorials Employing Visualizations, Resa M. Kelly and Sevil Akaygun, J. Chem. Educ., 2016, 93 (6), pp 1010–1019 DOI: 10.1021/acs.jchemed.6b00034 résumé de B.D. 2016-2017
    • biblio-10.1021-acs.jchemed.6b00047plugin-autotooltip__default plugin-autotooltip_bigUn spectromètre simple construit par des élèves pour étudier le rayonnement infrarouge et les gaz à effet de serre

      Article A Simple, Student-Built Spectrometer To Explore Infrared Radiation and Greenhouse Gases Mitchell R. M. Bruce, Tiffany A. Wilson, Alice E. Bruce, S. Max Bessey, and Virginia J. Flood, J. Chem. Educ., 2016, 93 (11), pp 1908–1915 DOI: 10.1021/acs.jchemed.6b00047 résumé de M.L. 2016-2017
    • biblio-10.1021-acs.jchemed.6b00248plugin-autotooltip__default plugin-autotooltip_bigÉtude des phénomènes de dissolution et de précipitation avec un microscope "Smartphone"

      Article Investigating Dissolution and Precipitation Phenomena with a Smartphone Microscope Gregg J. Lumetta and Edgar Arcia, J. Chem. Educ., 2016, 93 (10), pp 1754–1759 DOI: 10.1021/acs.jchemed.6b00248 résumé de J.D. 2016-2017

      Au cours de leurs études, les élèves peuvent faire des observations macroscopiques au niveau des phénomènes de précipitation et de dissolution, mais n’ont jamais pu observer ces phé…
    • biblio-10.1021-acs.jchemed.6b00252plugin-autotooltip__default plugin-autotooltip_bigUne démonstration colorée pour visualiser et investiguer les concepts essentiels de l'équilibre chimique

      Article A Colorful Demonstration to Visualize and Inquire into Essential Elements of Chemical Equilibrium, Ingo Eilks and Ozcan Gulacar, J. Chem. Educ., 2016, 93 (11), pp 1904–1907 DOI: 10.1021/acs.jchemed.6b00252 résumé de M.H. 2016-2017. Lien
    • biblio-10.1021-acs.jchemed.6b00261plugin-autotooltip__default plugin-autotooltip_bigDéveloppement d’un test à trois niveaux comme outil de diagnostic valide pour l’identification de fausses conceptions sur les glucides

      Article Development of a Three-Tier Test as a Valid Diagnostic Tool for Identification of Misconceptions Related to Carbohydrates, Dušica D. Milenković, Tamara N. Hrin, Mirjana D. Segedinac, and Saša Horvat, J. Chem. Educ., 2016, 93 (9), pp 1514–1520 DOI: 10.1021/acs.jchemed.6b00261 résumé de H.D. 2016-2017
    • biblio-10.1021-acs.jchemed.6b00263plugin-autotooltip__default plugin-autotooltip_bigExplorations cinétiques du geyser Bonbon-Soda

      Article Kinetic Explorations of the Candy–Cola Soda Geyser Trevor P. T. Sims and Thomas S. Kuntzleman, J. Chem. Educ., 2016, 93 (10), pp 1809–1813 DOI: 10.1021/acs.jchemed.6b00263 résumé de E.M. 2016-2017

      Cet article aborde l’étude cinétique de la réaction responsable de l’effet geyser du mélange « mentos/boisson gazeuse ».
    • biblio-10.1021-acs.jchemed.6b00361plugin-autotooltip__default plugin-autotooltip_bigAtomic Tiles (tuiles atomiques) : Ressources à manipuler pour explorer la liaison et la structure moléculaire

      Article : Atomic Tiles: Manipulative Resources for Exploring Bonding and Molecular Structure , Alan L. Kiste, Rebecca G. Hooper, Gregory E. Scott, and Seth D. Bush, J. Chem. Educ., 2016, 93 (11), pp 1900–1903 DOI: 10.1021/acs.jchemed.6b00361 sur base de résumés de M.L. (2016-2017) et E.C. (2017-2018)
    • biblio-10.1021-acs.jchemed.6b00400plugin-autotooltip__default plugin-autotooltip_bigLa chimie de la photographie: un laboratoire formidable

      The Chemistry of Photography: Still a Terrific Laboratory Course for Nonscience Majors Simeen Sattar, J. Chem. Educ., 2017, 94 (2), pp 183–189 DOI: 10.1021/acs.jchemed.6b00400 Résumé de T.C., 2016-2017

      Un constat : l’avènement de la photographie numérique conduit à l’évincement de la photographie conventionnelle non seulement du marché économique, de la vie courante des citoyens mais aussi des départements de photographie des collèges et …
    • biblio-10.1021-acs.jchemed.6b00417plugin-autotooltip__default plugin-autotooltip_bigEnquête sur le raisonnement des étudiants face aux réactions acidobasiques

      Investigating Students’ Reasoning about Acid–Base Reactions Melanie M. Cooper, Hovig Kouyoumdjian, and Sonia M. Underwood, J. Chem. Educ., 2016, 93 (10), pp 1703–1712 DOI: 10.1021/acs.jchemed.6b00417 Résumé de S.C., 2016-2017
    • biblio-10.1021-acs.jchemed.6b00624plugin-autotooltip__default plugin-autotooltip_bigLe campus comme laboratoire vivant pour la durabilité: la connexion à la chimie

      Article Campus as a Living Laboratory for Sustainability: The Chemistry Connection T. Lindstrom and C. Middlecamp, J. Chem. Educ., 2017, 94 (8), pp 1036–1042, DOI: 10.1021/acs.jchemed.6b00624 résumé de F.P. 2017-2018

      C’est un article écrit par un chimiste et par un physicien. Il décrit l’enseignement dispensé par ceux-ci lors des 5 dernières années dans leur université et ce dans le cadre d’un cours de sciences …
    • biblio-10.1021-acs.jchemed.6b00676plugin-autotooltip__default plugin-autotooltip_bigQuantification des concentrations de protéines à l'aide de la colorimétrie par un Smartphone: une nouvelle méthode pour un test établi

      Article: Quantifying Protein Concentrations Using Smartphone Colorimetry: A New Method for an Established Test T. Gee, Eric Kehoe, William C. K. Pomerantz, and R. Lee Penn, J. Chem. Educ., 2017, 94 (7), pp 941–945 DOI: 10.1021/acs.jchemed.6b00676 résumé de A.O. 2017-2018
    • biblio-10.1021-acs.jchemed.6b00711plugin-autotooltip__default plugin-autotooltip_bigLes solutions aqueuses d'anions amphiprotiques sont elles acides, basiques, ou neutres ?

      Article : Are Aqueous Solutions of Amphiprotic Anions Acidic, Basic, or Neutral? A Demonstration with Common pH Indicators Jervee M. Punzalan and Voltaire G. Organo, J. Chem. Educ., 2017, 94 (7), pp 911–915 DOI: 10.1021/acs.jchemed.6b00711 résumé de V.L. 2017-2018
    • biblio-10.1021-acs.jchemed.6b00776plugin-autotooltip__default plugin-autotooltip_bigProduction rapide d'une membrane d'acétate de cellulose poreuse pour la filtration de l'eau à l'aide de produits chimiques facilement disponibles

      Article : Rapid Production of a Porous Cellulose Acetate Membrane for Water Filtration using Readily Available Chemicals, Adrian Kaiser, Wendelin J. Stark , and Robert N. Grass, J. Chem. Educ., 2017, 94 (4), pp 483–487 DOI: 10.1021/acs.jchemed.6b00776 résumé de E.C. 2017-2018
    • biblio-10.1021-acs.jchemed.6b00805plugin-autotooltip__default plugin-autotooltip_bigAmélioration de l'enseignement primaire et secondaire par la science et l'ingénierie des polymères

      Article Augmenting Primary and Secondary Education with Polymer Science and Engineering Rose K. Cersonsky, Leanna L. Foster, Taeyong Ahn, Ryan J. Hall, Harry L. van der Laan, and Timothy F. Scott, J. Chem. Educ., 2017, 94 (11), pp 1639–1646 DOI: 10.1021/acs.jchemed.6b00805 résumé de G.H. 2017-2018
    • biblio-10.1021-acs.jchemed.6b00844plugin-autotooltip__default plugin-autotooltip_bigExpérience de la bouteille bleue : Apprendre la chimie sans connaître les produits chimiques

      Article Blue Bottle Experiment: Learning Chemistry without Knowing the Chemicals T. Limpanuparb , C. Areekul, P. Montriwat, and U. Rajchakit, J. Chem. Educ., 2017, 94 (6), pp 730–737 DOI: 10.1021/acs.jchemed.6b00844 résumé de F.P. 2017-2018
    • biblio-10.1021-acs.jchemed.6b00891plugin-autotooltip__default plugin-autotooltip_bigDétermination de l'acidité titrable dans le vin à l'aide de méthodes potentiométriques, conductimétriques et photométriques

      Article : Determination of Titratable Acidity in Wine Using Potentiometric, Conductometric, and Photometric Methods Dietrich A. Volmer, Luana Curbani, Timothy A. Parker, Jennifer Garcia, Linda D. Schultz, and Endler Marcel Borges, J. Chem. Educ., 2017, 94 (9), pp 1296–1302 DOI: 10.1021/acs.jchemed.6b00891 résumé de J.D. 2017-2018
    • biblio-10.1021-acs.jchemed.6b00942plugin-autotooltip__default plugin-autotooltip_bigUne expérience médico-légale : le cas du crime au cinéma

      Article : A Forensic Experiment: The Case of the Crime at the Cinema J. M. Valente Nabais and Sara D. Costa, J. Chem. Educ., 2017, 94 (8), pp 1111–1117 DOI: 10.1021/acs.jchemed.6b00942 résumé de A.D. 2017-2018

      Introduction

      Cet article rapporte une activité expérimentale où les étudiants doivent analyser attentivement les preuves recueillies sur le lieu d’un crime, à savoir des fibres et des traces de rouge à lèvres. Les fibres sont a…
    • biblio-10.1021-acs.jchemed.6b00946plugin-autotooltip__default plugin-autotooltip_bigPoursuite chimique: un jeu de société Trivial modifié

      Article: Chemical Pursuit: A Modified Trivia Board Game Blakely M. Adair and Lyle V. McAfee, J. Chem. Educ., 2018, 95 (3), pp 416–418 DOI: 10.1021/acs.jchemed.6b00946 résumé de A.R. 2017-2018 + supporting info (fichiers du jeu)

      Introduction
    • biblio-10.1021-acs.jchemed.6b01024plugin-autotooltip__default plugin-autotooltip_big« Exploring Matter » : Une exposition interactive et peu coûteuse sur la chimie, pour les musées

      Article Exploring Matter: An Interactive, Inexpensive Chemistry Exhibit for Museums Steven Murov and Arnold Chavez, J. Chem. Educ., 2017, 94 (10), pp 1571–1579 DOI: 10.1021/acs.jchemed.6b01024 résumé de A.O. 2017-2018
    • biblio-10.1021-acs.jchemed.7b00165plugin-autotooltip__default plugin-autotooltip_bigEnseigner les composés organiques avec un jeu utilisant des notes collantes sur le front

      Article Teaching Classes of Organic Compounds with a Sticky Note on Forehead Game Kevin P. O’Halloran, J. Chem. Educ., 2017 DOI:10.1021/acs.jchemed.7b00165 résumé de F.H. 2017-2018

      Introduction

      L’auteur de l’article, professeur de chimie, s’est rendu compte que la mémorisation des groupements chimiques en chimie organique se relevait être difficile pour les élèves. Il s’est demandé comment rendre l’appr…
    • biblio-10.1021-acs.jchemed.7b00218plugin-autotooltip__default plugin-autotooltip_bigDécouvrir les éléments chimiques dans la nourriture

      Article Discovering the Chemical Elements in Food Antonio Joaquín Franco-Mariscal J. Chem. Educ., 2018, 95 (3), pp 403–409 DOI: 10.1021/acs.jchemed.7b00218 résumé de M.R. 2018-2019

      But de l'article

      Étudier les possibilités d’enseignement des éléments chimiques en combinant 4 stratégies: l’usage d’un contexte, l’apprentissage basé sur l’investigation, l’usage d’affiches et l’usage des QR codes. Projet : fait avec 26 élèves de 15 ans…
    • biblio-10.1021-acs.jchemed.7b00226plugin-autotooltip__default plugin-autotooltip_bigLe tableau périodique des personnes: Un cadre pour engager les étudiants d'introduction à la chimie

      Article The People Periodic Table: A Framework for Engaging Introductory Chemistry Students Adam Hoffman and Mark Hennessy, J. Chem. Educ., 2018, 95 (2), pp 281–285 DOI: 10.1021/acs.jchemed.7b00226 résumé de A.-C. N. 2018-2019
    • biblio-10.1021-acs.jchemed.7b00256plugin-autotooltip__default plugin-autotooltip_bigLe choc des chimistes: un blog gamifié pour maîtriser le concept de la stœchiométrie des réactifs limitants

      Article : Clash of Chemists: A Gamified Blog To Master the Concept of Limiting Reagent Stoichiometry, Nathalie V. le Maire, Dominique Ph. Verpoorten, Marie-Laure S. Fauconnier, and Catherine G. Colaux-Castillo, Journal of Chemical Education Article
    • biblio-10.1021-acs.jchemed.7b00295plugin-autotooltip__default plugin-autotooltip_bigUne (autre) modification de la démonstration de la fontaine ammoniacale

      Article A(nother) Modification of the Ammonia Fountain Demonstration Ben Ruekberg and David L. Freeman, J. Chem. Educ., 2017, 94 (10), pp 1397–1398 DOI: 10.1021/acs.jchemed.7b00295 résumé de G.H. 2017-2018

      + Le texte complet

      Cet article, publié dans le
    • biblio-10.1021-acs.jchemed.7b00404plugin-autotooltip__default plugin-autotooltip_bigExploration des substances mystérieuses, X et Y: remettre en question l’opinion des étudiants sur la chimie acide-base et l’équilibre chimique

      Article Exploring the Mysterious Substances, X and Y: Challenging Students’ Thinking on Acid–Base Chemistry and Chemical Equilibrium Ingo Eilks, Ozcan Gulacar, and Jose Sandoval, J. Chem. Educ., 2018, 95 (4), pp 601–604 DOI: 10.1021/acs.jchemed.7b00404 résumé de A.-C. N. 2018-2019
    • biblio-10.1021-acs.jchemed.7b00475plugin-autotooltip__default plugin-autotooltip_bigDémonstrations de magnétisme et d'oxydation par la combustion de comprimés de supplément de fer

      Article : Demonstrations of Magnetism and Oxidation by Combustion of Iron Supplement Tablets Max J. Palmer, Keri A. Martinez, Mayuresh G. Gadgil, and Dean J. Campbell J. Chem. Educ., 2018, 95 (3), pp 423–427 DOI: 10.1021/acs.jchemed.7b00475 résumé de A.D. 2017-2018
    • biblio-10.1021-acs.jchemed.7b00548plugin-autotooltip__default plugin-autotooltip_bigDémonstration des principes de spectrophotométrie en construisant un spectrophotomètre se basant sur le capteur de luminosité d’un smartphone

      Article : Demonstrating Principles of Spectrophotometry by Constructing a Simple, Low-Cost, Functional Spectrophotometer Utilizing the Light Sensor on a Smartphone Bill S. Hosker, J. Chem. Educ., 2018, 95 (1), pp 178–181 DOI: 10.1021/acs.jchemed.7b00548 résumé de J.P. 2018-2019
    • biblio-10.1021-acs.jchemed.7b00558plugin-autotooltip__default plugin-autotooltip_bigApproche basée sur les problèmes pour l'enseignement des laboratoires avancés de chimie et le développement de compétences de réflexion critique des étudiants

      Article : Problem-Based Approach to Teaching Advanced Chemistry Laboratories and Developing Students’ Critical Thinking Skills, Joseph G. Quattrucci, J. Chem. Educ., 2018, 95 (2), pp 259–266 DOI: 10.1021/acs.jchemed.7b00558 résumé de J.D. 2017-2018
    • biblio-10.1021-acs.jchemed.7b00680plugin-autotooltip__default plugin-autotooltip_bigDémonstration de la séquestration du CO2 à l'aide d'olivine et de boissons gazeuses avec des étudiants du secondaire pour étudier les concepts de pH et de conductivité électrique

      Demonstrating CO2 Sequestration Using Olivine and Carbonated Beverages with Secondary School Students To Investigate pH and Electrical Conductivity Concepts Johan A. Linthorst and Johanna van der Wal-Veuger, J. Chem. Educ., 2018, 95 (9), pp 1612–1614 DOI: 10.1021/acs.jchemed.7b00680 résumé de F.G. 2018-2019
    • biblio-10.1021-acs.jchemed.7b00690plugin-autotooltip__default plugin-autotooltip_bigClasse "Escape" : Le processus Leblanc - Un «jeu d'évasion» éducatif

      Article : Escape Classroom: The Leblanc Process—An Educational "Escape Game" Nicolas Dietrich, J. Chem. Educ., 2018, 95 (6), pp 996–999 DOI: 10.1021/acs.jchemed.7b00690 résumé de A.M. 2018-2019

      Introduction:

      Un escape game pédagogique est un jeu d'évasion virtuel ou non, à réaliser en groupe et construit sur une succession d'énigmes permettant d'atteindre un but. Dans notre cas, il s’agit de trouver des combinaisons de nom…
    • biblio-10.1021-acs.jchemed.7b00739plugin-autotooltip__default plugin-autotooltip_bigLa chimie des bonbons: une approche douce pour enseigner aux sections non scientifiques

      Article : Chemistry of Candy: A Sweet Approach to Teaching Nonscience Majors Jennifer Logan Bayline, Halie M. Tucci, David W. Miller, Kaitlin D. Roderick, and Patricia A. Brletic, J. Chem. Educ., 2018, 95 (8), pp 1307–1315 DOI: 10.1021/acs.jchemed.7b00739 résumé de A.W. 2018-2019
    • biblio-10.1021-acs.jchemed.7b00845plugin-autotooltip__default plugin-autotooltip_bigDissolution de sels dans l'eau : explications particulaires par les élèves des changements de température

      Article Dissolving Salts in Water: Students’ Particulate Explanations of Temperature Changes Timothy N. Abell and Stacey Lowery Bretz, J. Chem. Educ., 2018, 95 (4), pp 504–511 DOI: 10.1021/acs.jchemed.7b00845 résumé de S.V. 2017-2018
    • biblio-10.1021-acs.jchemed.7b00849plugin-autotooltip__default plugin-autotooltip_bigTouchez vite! Jouer à un jeu de symétrie moléculaire pour une évaluation pratique et formative de la compréhension des concepts de symétrie par les étudiants

      Article : Tap It Fast! Playing a Molecular Symmetry Game for Practice and Formative Assessment of Students’ Understanding of Symmetry Concepts Ricardo Dagnoni Huelsmann, Andrei Felipe Vailati, Lucas Ribeiro de Laia, Patrícia Salvador Tessaro, and Fernando Roberto Xavier, J. Chem. Educ., 2018, 95 (7), pp 1151–1155 DOI: 10.1021/acs.jchemed.7…
    • biblio-10.1021-acs.jchemed.7b00978plugin-autotooltip__default plugin-autotooltip_bigL'alchimie ancienne dans la salle de classe: une pyrotechnie déflagrante à base de miel

      Article : Ancient Alchemy in the Classroom: A Honey-Based, Deflagrating Pyrotechnic A. V. Wolfenden, N. L. kilah, J. Chem. Educ., 2018, 95 (8), pp 1350–1353 DOI:10.1021/acs.jchemed.7b00978 résumé de A.R. 2017-2018

      Introduction
    • biblio-10.1021-acs.jchemed.8b00129plugin-autotooltip__default plugin-autotooltip_bigAnalyse et identification des principaux acides organiques dans les vins et les jus de fruits par chromatographie sur papier

      Article Analysis and Identification of Major Organic Acids in Wine and Fruit Juices by Paper Chromatography Dulani Samarasekara, Courtney Hill, and Deb Mlsna, J. Chem. Educ., 2018, 95 (9), pp 1621–1625 DOI: 10.1021/acs.jchemed.8b00129 résumé de A.M. 2018-2019
    • biblio-10.1021-acs.jchemed.8b00133plugin-autotooltip__default plugin-autotooltip_bigDémonstrations chimiques et attention visuelle : La configuration est elle importante? Mise en évidence issue d'une étude du suivi oculaire, en approche double aveugle

      Article Chemistry Demonstrations and Visual Attention: Does the Setup Matter? Evidence from a Double-Blinded Eye-Tracking Study Andreas Nehring and Sebastian Busch, J. Chem. Educ., 2018, 95 (10), pp 1724–1735 DOI: 10.1021/acs.jchemed.8b00133 résumé de M.M.M. 2018-2019
    • biblio-10.1021-acs.jchemed.8b00152plugin-autotooltip__default plugin-autotooltip_bigJouer avec le feu: expertise requise en matière de sécurité chimique

      Article Playing with Fire: Chemical Safety Expertise Required Samuella B. Sigmann, J. Chem. Educ., 2018, 95 (10), pp 1736–1746 DOI: 10.1021/acs.jchemed.8b00152 résumé de M.R. 2018-2019

      Au cours des 20 dernières années, 164 enfants et éducateurs auraient été blessés lors de laboratoire utilisant des solvants inflammables.
    • biblio-10.1021-acs.jchemed.8b00296plugin-autotooltip__default plugin-autotooltip_bigContenu pédagogique sur la cinétique chimique: sélection de critères pour aborder expérimentalement les conceptions intuitives des étudiants

      Article Pedagogical Content Knowledge of Chemical Kinetics: Experiment Selection Criteria To Address Students’ Intuitive Conceptions Ainoa Marzabal, Virginia Delgado, Patricia Moreira, Lorena Barrientos, and Jeannette Moreno, J. Chem. Educ., 2018, 95 (8), pp 1245–1249 DOI: 10.1021/acs.jchemed.8b00296 résumé de F.G. 2018-2019
    • biblio-10.1021-acs.jchemed.8b00378plugin-autotooltip__default plugin-autotooltip_bigTampon en contexte : lingettes pour bébé comme solution tampon

      Article : Buffers in Context: Baby Wipes As a Buffer System Jon-Marc G. Rodriguez, Sarah Hensiek, Jeanne R. Meyer, Cynthia J. Harwood, and Marcy H. Towns, J. Chem. Educ., 2018, 95 (10), pp 1816–1820 DOI: 10.1021/acs.jchemed.8b00378 résumé de M.M.M. 2018-2019
    • biblio-10.1021-acs.jchemed.8b00381plugin-autotooltip__default plugin-autotooltip_bigCréation et expérimentation d'un système robuste et peu coûteux pour démontrer visuellement la pression de vapeur des liquides en fonction de la température

      Article : Creating and Experimenting with a Low-Cost, Rugged System to Visually Demonstrate the Vapor Pressure of Liquids as a Function of Temperature Rodrigo Papai, Mayara Araujo Romano, Aline Rodrigues Arroyo, Bárbara Rodrigues da Silva, Bruno Tresoldi, Gabriela Cabo Winter, Julia Messias Costa, Maria Aparecida Freitas Santos, Matheus Dam…
    • biblio-10.1021-acs.jchemed.8b00479plugin-autotooltip__default plugin-autotooltip_bigComment les batteries stockent et libèrent de l'énergie: explications de l'électrochimie de base

      How Batteries Store and Release Energy: Explaining Basic Electrochemistry Klaus Schmidt-Rohr, J. Chem. Educ., 2018, 95 (10), pp 1801–1810 DOI: 10.1021/acs.jchemed.8b00479 résumé de E.F. 2018-2019

      Les batteries sont considérées comme des dispositifs qui stockent l’énergie chimique et la convertissent en énergie électrique. Malheureusement, la description standard de l'électrochimie n'explique pas p…
    • biblio-10.1021-ed074p262_10.1039-b801297kplugin-autotooltip__default plugin-autotooltip_bigApproche scientifique de l'enseignement de la chimie

      Résumés de A.V.V, 2009-2010 (articles d'intérêt didactique) :

      * A.H. Johnstone, Chemistry Teaching – Science or Alchemy 1996 Brasted Lecture, Journal of Chemical Education, 1997, 74, 262-268. DOI: 10.1021/ed074p262 * N. Reid,
    • biblio-10.1021-ed076p1136plugin-autotooltip__default plugin-autotooltip_bigApprentissages actif et coopératif dans les cours de chimie organique

      Active Learning and Cooperative Learning in the Organic Chemistry Lecture Class, Donald R. Paulson, J. Chem. Educ., 1999, 76 (8), p 1136. Résumé de A.B., 2011-2012. Article d'intérêt didactique

      Introduction

      Dans nos universités, bons nombres de cours se présentent sous la forme d'exposés ex-cathedra, de lecture(s), de présentation powerpoint. Cette pratique n'est pas nouvelle, toutefois, nous pourrions nous poser la questio…
    • biblio-10.1021-ed078p481plugin-autotooltip__default plugin-autotooltip_bigLa chimie dans les films contemporains

      Almost Like Weighing Someone’s Soul”: Chemistry in Contemporary Film, Donald J. Wink, J. Chem. Ed.Vol. 78 No. 4 April 2001, pp 481-483. Résumé de V.L., 2009-2010

      L’utilisation de courts clips vidéo de différents films populaires constitue un moyen ludique de présenter des exemples « vivants » de théories ou faits importants dans l’enseignement de la chimie. Exemples de films utilisés : Apollo 13, A la poursuite de l’arche perdue, Légende d’automne, the ro…
    • biblio-10.1021-ed080p779plugin-autotooltip__default plugin-autotooltip_bigEnseigner la chimie organique via la taxonomie de Bloom ?

      Teaching Introductory Organic Chemistry: “Blooming beyond a Simple Taxonomy, M.D. Pungente, R.A. Badger, J.Chem.Educ., 2003, 80, 779. Résumé de D.F. 2010-2011. Article d'intérêt didactique

      Introduction

      Souvent, la chimie organique est vue pour la plupart des élèves comme la bête noire des sciences. Ils doivent s’accrocher toute l’année pour passer et espèrent mémoriser suffisamment pour réussir ce cours. Les élèves s’inscrivent en chim…
    • biblio-10.1021-ed082p131plugin-autotooltip__default plugin-autotooltip_bigÉvaluation de la compréhension des étudiants sur la conception d’équations équilibrées et les proportions stoechiométriques en utilisant des dessins

      Evaluating Students' Conceptual Understanding of Balanced Equations and Stoichiometric Ratios Using a Particulate Drawing Michael J. Sanger, J. Chem. Educ., 2005, 82 (1), p 131 DOI: 10.1021/ed082p131 Sur base d'un résumé de N. B., AESS 2006-2007. Article d'intérêt didactique.
    • biblio-10.1021-ed083p791plugin-autotooltip__default plugin-autotooltip_bigValence, nombre oxydation et charge formelle : Trois concepts liés mais fondamentalement différents

      Valence, Oxidation Number, and Formal Charge: Three Related but Fundamentally Different Concepts De Gerard Parkin, J. Chem Ed. Vol. 83 No. 5 may 2006, pp 791-799) résumé de J.L., 2007-2008

      Les termes de « valence » et d’ « oxydation » apparaissent fréquemment dans les textes à la fois élémentaires mais aussi avancés de la chimie. Cependant, il est évident à partir de la littérature que ces terme…
    • biblio-10.1021-ed083p954plugin-autotooltip__default plugin-autotooltip_bigFausse conceptions à propos de la nature particulaire de la matière. Utiliser des animations pour combler l'écart entre les genres

      Misconceptions about the Particulate Nature of Matter. Using Animations To Close the Gender Gap, Ellen J. Yezierski, James P. Birk, J. Chem. Educ., 2006, 83 (6), p 954 DOI: 10.1021/ed083p954. Résumé X.V., 2012-2013.
    • biblio-10.1021-ed083p1094plugin-autotooltip__default plugin-autotooltip_bigComment motiver les étudiants à étudier avant un laboratoire

      How To Motivate Students To Study before They Enter the Lab, Lea Pogacnik et Blaz Cigic, J. Chem Ed. Vol. 83 No. 7 Augustus 2006, pp 1094-1098) Résumé de A.W, 2006-2007

      Des études ont montré que les étudiants ne préparent pas suffisamment leur séances de laboratoire pendant leurs études supérieures et consacrent généralement plus de temps aux activités post-laboratoire telles que la rédaction des rapports. Il a été remarqué également…
    • biblio-10.1021-ed083p1182plugin-autotooltip__default plugin-autotooltip_bigUn laboratoire utilisant des modèles moléculaires pour une introduction en chimie

      A laboratory experiment using molecular models for an introductory chemistry class, Shahrokh Ghaffari, J. Chem Ed. Vol. 83 No. 8 Augustus 2006, pp 1182-1184. Sur base d'un résumé de C. B., AESS 2006-2007.

      Depuis le milieu du 19ème siècle, l’utilisation de modèles moléculaires est de plus en plus répandue tant dans la recherche scientifique que dans l’enseignement des sciences. En effet, on trouve dans quasi tous …
    • biblio-10.1021-ed083p1317plugin-autotooltip__default plugin-autotooltip_bigClassifier la matière : modèle utilisant des attaches-trombonnes

      Classifying matter : a physical model using paper clips, Bob Blake, Lynn Hogue & Jerry L. Sarquis, J. Chem. Ed. Vol. 83 No. 9 September 2006, pp 1317-1318 + supplement). Sur base d'un résumé de K. R., AESS 2006-2007.

      Les élèves ont des difficultés à visualiser le monde des chimistes et leur langage spécifique. Au début de leurs études, les élèves peinent à apprendre et à appliquer la définition des termes
    • biblio-10.1021-ed083p1479plugin-autotooltip__default plugin-autotooltip_bigLa magie chimique de J.K. Rowling

      The Chemical Wizardry of J.K. Rowling, Copes J.S., J. Chem. Ed. 83(10), 2006, 1479-1483. Résumé de V.L., 2009-2010.

      En parcourant les 6 volumes des aventures d’Harry Potter, l’auteur a mis en évidence une chimie explicable et sérieuse avec des phénomènes tels que des bulles, des étincelles, des flammes colorées,… IL y a puisé beaucoup d’inspiration pour des démonstrations chimiques de magie pour des classes d’élèves ou des camps en établissant des connections …
    • biblio-10.1021-ed084p172plugin-autotooltip__default plugin-autotooltip_bigDeux types de problèmes conceptuels dans l’enseignement de la chimie

      Two Kinds of Conceptual Problems in Chemistry Teaching + supplement, Zuzana Haláková and Miroslav Proksa, Journal of Chemical Education Vol. 84 No. 1 January 2007, p 172-174. Résumé de L.B., 2010-2011. Article d'intérêt didactique
    • biblio-10.1021-ed084p1140plugin-autotooltip__default plugin-autotooltip_bigL'erreur de considérer ses élèves comme des Mendeleïev un seul jour

      Mistake of Having Students Be Mendeleev for Just a Day, Brett Criswell, J. Chem. Educ., 2007, 84 (7), p 1140 DOI: 10.1021/ed084p1140

      En apparence, expliquer aux élèves comment les éléments chimiques ont été classés peut paraître simple. On pourrait en effet se contenter de leur présenter les différents groupes (gaz, métaux, non-métaux, terreux), comme l'envisageait Lavoisier, en 1789. Mais cela présente deux lacunes : D'une pa…
    • biblio-10.1021-ed085p145plugin-autotooltip__default plugin-autotooltip_bigLe rôle des laboratoires dans l’apprentissage de la chimie

      The role of the laboratory in the chemistry instruction, M.J.Elliot, K.K.Steward and J.J.Lagowski, J. Chem Ed. Vol. 85 No. 1 January 2008, p 145-149. Résumé de N.S., 2008-2009

      De nos jours peu de professeurs (instructeurs) envisagent de donner un cours de chimie de base sans laboratoire. Aussi, les chimistes académiciens et industriels privilégient beaucoup les laboratoires en complément de la théorie, surtout pour les étudiants prépar…
    • biblio-10.1021-ed085p1372plugin-autotooltip__default plugin-autotooltip_bigEnseignement de l’hypothèse d’Avogadro en aidant les étudiants à voir le monde autrement

      Teaching Avogadro's Hypothesis and Helping Students to See the World Differently Brett Criswell, J. Chem. Educ., 2008, 85 (10), p 1372 DOI: 10.1021/ed085p1372 Résumé de N.G., 2008-2009

      L’auteur s’est intéressé aux travaux de monsieur Chi et de ses collaborateurs sur l’ontologie («étude de ce qui est réel et de ce qui ne l’est pas) et les fausses conceptions en sciences. Le modèle qui a été développé pour e…
    • biblio-10.1021-ed086p820plugin-autotooltip__default plugin-autotooltip_bigPréparer les étudiants à bénéficier d’une activité de recherche de base au laboratoire : guide et suggestion

      Preparing students to benefit from inquiry-based activities in de chemistry laboratory : guidelines and suggestions, Laura B.Bruck and Marcy H. towns, Journal of chemical education, Vol 86 N°7 july 2009 - Résumé de M.P., 2009-2010

      Les activités de recherche au laboratoire sont indispensables pour enseigner les sciences. Il s’agit d’une méthode pédagogique qui combine à la fois : activit…
    • biblio-10.1021-ed086p1195plugin-autotooltip__default plugin-autotooltip_bigInfluence du Grec ancien sur la terminologie en Chimie

      Influences of Ancient Greek on Chemical Terminology, Peter Loyson, Journal of Chemical Education, Vol. 86 No. 10 October 2009, 1195-1199. Résumé de L.M., 2009-2010

      La civilisation Grecque ancienne a prospéré de -700 ans avant notre ère jusqu’à 100 ans après et est, à juste titre, qualifiée de classique pour ses contributions majeures aux différents savoirs humains, spécialement dans les domaines de la philosophie, l’astronomie, la littérat…
    • biblio-10.1021-ed086p1202plugin-autotooltip__default plugin-autotooltip_bigCombinaison de la chimie et de la musique pour augmenter l'intérêt des étudiants. Utilisation des chansons pour accompagner des matières chimiques

      Combining Chemistry and Music To Engage Student Interest", Using Songs To Accompany Selected Chemical Topics, A.M. Last, J. Chem. Ed. Vol. 86 No. 10 October 2009, pp 1202-1204 - Résumé de L.M., 2009-2010
    • biblio-10.1021-ed086p1216plugin-autotooltip__default plugin-autotooltip_bigLes séries télévisées médicales comme études de cas en biochimie

      Television Medical Dramas as Case Studies in Biochemistry, Julie T. Millard, Journal of Chemical Education • Vol. 86 No. 10 • October 2009 • 1216-1218. Résumé de M.G., 2010-2011.

      Introduction

      Le cours biochimie a généralement un rythme soutenu. Les étudiants sont souvent tellement occupés à prendre des notes qu'ils ne réfléchissent pas au sujet du cours. Une rupture de la leçon avec de courtes périodes, obligeant les élèves à ré…
    • biblio-10.1021-ed086p1277plugin-autotooltip__default plugin-autotooltip_bigLa chimie des produits alimentaires auto-chauffants

      The Chemistry of Self-Heating Food Products, Martin T. Oliver-Hoyo, Gabriel Pinto, Juan Antonio Llorens-Molina. Journal of Chemical Education vol. 86, No. 11, November 2009, p1277-1280. Résumé par M.C., 2009-2010

      Les boîtes auto chauffantes ou auto réfrigérantes pour les repas ou les boissons sont d’excellents exemples de l’application de la chimie dans la vie de tous les jours. Ces systèmes sont composés de deux récipients : l’un stocke la n…
    • biblio-10.1021-ed086p1433plugin-autotooltip__default plugin-autotooltip_bigMettre l’accent sur la représentation à plusieurs niveaux afin d’augmenter la compréhension des étudiants concernant les changements se produisant durant des réactions chimiques

      Emphasizing Multiple Levels of Representation To Enhance Students'Understandings of the Changes Occuring during Chemical Reactions, A.L. Chandrasegaran and David F. Treagust, J. Chem. Educ. December 2009 vol. 86 N°12, 1433-1436. Résumé de T.D., 2009-2010.
    • biblio-10.1021-ed100218zplugin-autotooltip__default plugin-autotooltip_bigComment introduire la notion d’aromaticité chimique ?

      Discovering Chemical Aromaticity Using Fragrant Plants, T.L. Schneider, J.Chem.Educ. 2010, 87(8), 793-795. Résumé de D.F., 2010-2011

      But de l’activité

      Le but de cette activité est d’étudier la notion d’aromaticité chimique. Pour ce faire, le professeur a voulu mettre en place une situation permettant de relier la chimie organique à la vie quotidienne. Le challenge demandé aux étudiants est de choisir une plante odorante et d’identifier la …
    • biblio-10.1021-ed100390splugin-autotooltip__default plugin-autotooltip_bigA quel point ton essence est-elle verte ? Création et comparaison de biocarburants

      How green is your fuel ? Creation and comparison of automotive biofuels, Eugene P. Wagner, Maura A. Koehle, Todd M. Moyle, and Patrick D. Lambert, Journal of Chemical Education, 2010, 87(7), 711-713. Résumé de N.L., 2010-2011

      L’avenir des biocarburants
    • biblio-10.1021-ed100409pplugin-autotooltip__default plugin-autotooltip_bigCombien de temps les étudiants peuvent-ils prêter attention en classe ? Une étude de la baisse d’attention de l’étudiant en utilisant des clickers

      How Long Can Students Pay Attention in Class? A Study of Student Attention Decline Using Clickers, D.M. Bunce, E.A. Flens and K.Y. Neiles, Journal of Chemical Education, 2010, 87(12), 1438-1443. Résumé de S.S., 2010-2011.
    • biblio-10.1021-ed100422cplugin-autotooltip__default plugin-autotooltip_bigUtilisation de la théorie de réponses aux items (IRT) pour évaluer les changements de performance des étudiants basés sur les changements dans la formulation des questions

      Using Item Response Theory To Assess Changes in Student Performance Based on Changes in Question Wording, Kimberly D. Schurmeier, Charles H. Atwood, Carrie G. Shepler, Gary J. Lautenschlager Journal of Chemical Education, vol 87(11) 2010 pp 1268–1272 (Article) DOI: 10.1021/ed100422c - Résumé de S.S., 2010-2011.
    • biblio-10.1021-ed100492aplugin-autotooltip__default plugin-autotooltip_bigCes chimistes de pharaons

      Chemistry in the time of the pharaons, Peter Loyson, Journal of Chemical Education, 2011, 88 (2), pp 146–150. Résumé de N.L. 2010-2011).

      Les pharaons, une longueur d’avance !

      Grâce à l’abondance des ressources naturelles de l’Egypte (ex : les minéraux, pierres précieuses et usuelles) et à leur ingéniosité, les anciens Egyptiens ont été des pionniers dans beaucoup de domaines comme par exemple :
    • biblio-10.1021-ed100849bplugin-autotooltip__default plugin-autotooltip_bigMon acide peut battre ton acide

      My Acid Can Beat Up Your Acid! Alice Putti J. Chem. Educ., 2011, 88 (9), pp 1278–1280 DOI: 10.1021/ed100849b résumé de A-P.C., 2010-2011

      Il s'agit d'une activité à réaliser en classe avec les élèves. Celle-ci leur permet d'étudier la différence entre les acides forts et les acides faibles. En effet, grâce aux formules de calcul de pH, la plupart des élèves savent qu'une solution d'acide fort 0,1M aura un pH d'environ 1 alors qu'une solution d'acide faible de m…
    • biblio-10.1021-ed101160xplugin-autotooltip__default plugin-autotooltip_bigCréation d'un environnement d'apprentissage positif par l'utilisation de clickers en classes de chimie dans le secondaire

      Creating a Positive Learning Environment with the Use of Clickers in a High School Chemistry Classroom, Fred Vital, J. Chem. Educ. 2012, 89, 470-473. Résumé de B.V.A., 2011-2012.

      Introduction

      Les clickers sont de petits dispositifs manuels, utilisés typiquement à l’Université pour répondre directement aux questions posées en classe. Bien que leur efficacité soit non conc…
    • biblio-10.1021-ed200823tplugin-autotooltip__default plugin-autotooltip_bigIdentification de pigments végétaux : activité et situation d'apprentissage

      Plant Pigment Identification: A Classroom and Outreach Activity Kathleen C. A. Garber et al J. Chem. Educ., 2013, 90 (6), pp 755–759 DOI: 10.1021/ed200823t résumé de S.P. 2014-2015

      Objectif de l'article

      Séance de laboratoire sur l'identification de composés chimiques particuliers, les anthocyanines, colorants naturels des plantes.
    • biblio-10.1021-ed300092tplugin-autotooltip__default plugin-autotooltip_bigMettez un peu de cinéma Wow! dans votre enseignement de chimie

      Put Some Movie Wow! in Your Chemistry Teaching, Christopher A. Frey, Marjorie L. Mikasen, Mark A. Griep, J. Chem. Educ., 2012, 89 (9), pp 1138–1143 DOI: 10.1021/ed300092t Résumé de A-P.C., 2012-2013.

      Tout comme Jurassic Park a été utilisé comme base de discussions sur la structure des protéines, de l'ADN, le clonage, etc
    • biblio-10.1021-ed300155pplugin-autotooltip__default plugin-autotooltip_bigFait ou Fiction ? La chimie aide les élèves à déterminer la vraissemblance de situations d'émissions de télévision

      Fact or Fiction? General Chemistry Helps Students Determine the Legitimacy of Television Program Situations Mark A. Milanick and Ruth L. Prewitt, J. Chem. Educ., 2013, 90 (7), pp 904–906 DOI: 10.1021/ed300155p Sur base d'un résumé de M.M. 2013-2014
    • biblio-10.1021-ed300329eplugin-autotooltip__default plugin-autotooltip_bigChimie "on the go" : revue d'applications pour smartphone en chimie

      Chemistry on the Go: Review of Chemistry Apps on Smartphones Diana Libman and Ling Huang, J. Chem. Educ., 2013, 90 (3), pp 320–325 DOI: 10.1021/ed300329e (résumé de D.D. 2014-2015)

      De nos jours, quasi tous les jeunes ont un smartphone. De nombreuses applications mobiles ont alors vu le jour. Elles recouvrent un large éventail de fonctionnalités et disciplines. Les plus importantes, et presque toutes gratuites liées à la chimi…
    • biblio-10.1021-ed300445bplugin-autotooltip__default plugin-autotooltip_bigOpéra et poison : une approche secrète et agréable pour enseigner et apprendre la chimie

      Opera and Poison: A Secret and Enjoyable Approach To Teaching and Learning Chemistry, João Paulo André, J. Chem. Educ., 2013, 90 (3), pp 352–357 DOI: 10.1021/ed300445b Résumé de D.D., 2014-2015

      Article d'intérêt dans le domaine pharmaceutique
    • biblio-10.1021-ed300456yplugin-autotooltip__default plugin-autotooltip_bigUne nouvelle approche de la chimie et un modèle pour réformer le curriculum

      Chemistry, Life, the Universe, and Everything: A New Approach to General Chemistry, and a Model for Curriculum Reform Melanie Cooper and Michael Klymkowsky, J. Chem. Educ., 2013, 90 (9), pp 1116–1122 DOI: 10.1021/ed300456y

      Résumé

      Pendant de nombreuses années, la chimie a connu de nombreuses réformes mais qui étaient surtout basées sur ce qui doit être enseigné, comme par exemple la nomenclature chimique, et pas sur ce…
    • biblio-10.1021-ed300694nplugin-autotooltip__default plugin-autotooltip_big“Quantifying the Soda Geyser”

      Quantifying the Soda Geyser Christopher J. Huber and Aaron M. Massari, J. Chem. Educ., 2014, 91 (3), pp 428–431 DOI: 10.1021/ed300694n résumé de N.M. 2014-2015

      Cet article se propose de décrire les phénomènes mis en jeu lors de l’ajout d’un Mentos® dans une bouteille de Coca®, formant ainsi le fameux « Soda Geyser ». Pour ce faire, un raisonnement déductif (essais-erreurs) sera proposé aux élèves.
    • biblio-10.1021-ed400091wplugin-autotooltip__default plugin-autotooltip_bigUne méthode efficace pour présenter le tableau périodique comme un jeu de mots croisés au niveau secondaire

      Article An Effective Method of Introducing the Periodic Table as a Crossword Puzzle at the High School Level Sushama D. Joag, J. Chem. Educ., 2014, 91 (6), pp 864–867 DOI: 10.1021/ed400091w résumé de J.-L.D. 2016-2017

      L’article présente une nouvelle méthode d’apprentissage pour introduire le tableau périodique aux élèves du secondaire. Le public essentiellement visé est celui des ado…
    • biblio-10.1021-ed400128xplugin-autotooltip__default plugin-autotooltip_bigSignification du concept de la mole pour les étudiants et les professeurs du secondaire

      Unpacking the Meaning of the Mole Concept for Secondary School Teachers and Students Su-Chi Fang, Christina Hart, and David Clarke, J. Chem. Educ., 2014, 91 (3), pp 351–356 DOI: 10.1021/ed400128x résumé de J.V. 2014-2015

      La mole est un concept fondamental en chimie quantitative, et pourtant des recherches ont démontré que l’apprentissage de ce concept était des plus difficiles. Cet article contient une re…
    • biblio-10.1021-ed400363uplugin-autotooltip__default plugin-autotooltip_bigChangement climatique : une démonstration didactique

      Climate Change: A Demonstration with a Teaching Moment Steven Murov, J. Chem. Educ., 2013, 90 (11), pp 1486–1487 DOI: 10.1021/ed400363u résumé de S.P. 2014-2015

      * Objectif de l'article : Expérience visant à démontrer que le dioxyde de carbone n'est pas un composant majeur de l'atmosphère
    • biblio-10.1021-ed400379gplugin-autotooltip__default plugin-autotooltip_bigProduction en laboratoire de liqueur de citron (Limoncello) par macération conventionnelle et un système à deux seringues pour illustrer l'extraction dynamique rapide solide-liquide

      Article Laboratory Production of Lemon Liqueur (Limoncello) by Conventional Maceration and a Two-Syringe System To Illustrate Rapid Solid–Liquid Dynamic Extraction Daniele Naviglio, Domenico Montesano, and Monica Gallo, J. Chem. Educ., 2015, 92 (5), pp 911–915 DOI: 10.1021/ed400379g résumé de J.D. 2016-2017
    • biblio-10.1021-ed400523mplugin-autotooltip__default plugin-autotooltip_bigLa biologie et la chimie du brassage : un cours interdisciplinaire

      The Biology and Chemistry of Brewing: An Interdisciplinary Course Paul D. Hooker, William A. Deutschman, and Brian J. Avery, J. Chem. Educ., 2014, 91 (3), pp 336–339 DOI: 10.1021/ed400523m résumé de S.P. 2014-2015

      Dans cet article, les auteurs, exposent les principes d’un cours interdisciplinaire sur le thème de la brasserie, cours qu’ils ont mis en place depuis neuf ans et qui a la particularité de créer des liens concrets e…
    • biblio-10.1021-ed400551cplugin-autotooltip__default plugin-autotooltip_bigActivités en classe par manipulation de trombones pour introduire les structures et les propriétés des polymères

      Polymer Basics: Classroom Activities Manipulating Paper Clips To Introduce the Structures and Properties of Polymers Yunusa Umar, J. Chem. Educ., 2014, 91 (10), pp 1667–1670 DOI: 10.1021/ed400551c résumé de F.M. 2014-2015

      Pour améliorer la compréhension des concepts de base et la visualisation des structures des polymères, différentes activités peuvent être réalisées en classe en …
    • biblio-10.1021-ed400851mplugin-autotooltip__default plugin-autotooltip_bigIntégration de senseurs en papier à base de nanoparticules : un exemple d’application pour une analyse colorimétrique rapide d’antioxydants

      Article Integration of Nanoparticle-Based Paper Sensors into the Classroom: An Example of Application for Rapid Colorimetric Analysis of Antioxidants Erica Sharpe and Silvana Andreescu, J. Chem. Educ., 2015, 92 (5), pp 886–891 DOI: 10.1021/ed400851m résumé de G.D. 2015-2016
    • biblio-10.1021-ed400901xplugin-autotooltip__default plugin-autotooltip_bigRemplissage d'un sac en plastique avec du dioxyde de carbone: un laboratoire par démarche d'investigation guidée

      Article : Filling a Plastic Bag with Carbon Dioxide: A Student-Designed Guided-Inquiry Lab for Advanced Placement and College Chemistry Courses, Laura M. Lanni, Journal of Chemical Education 2014 91 (9), 1390-1392 DOI: 10.1021/ed400901x résumé de N.D. 2017-2018

      Introduction
    • biblio-10.1021-ed500401dplugin-autotooltip__default plugin-autotooltip_bigAppareil microfluidique colorimétrique à bas coût, à base de papier et caméra pour téléphone portable

      Article : Cost Effective Paper-Based Colorimetric Microfluidic Devices and Mobile Phone Camera Readers for the Classroom Myra T. Koesdjojo, Sumate Pengpumkiat, Yuanyuan Wu, Anukul Boonloed, Daniel Huynh, Thomas P. Remcho, and Vincent T. Remcho, J. Chem. Educ., 2015, 92 (4), pp 737–741 DOI: 10.1021/ed500401d résumé de R.D. BAB2 chimie 2018-2019
    • biblio-10.1021-ed500615aplugin-autotooltip__default plugin-autotooltip_bigCréer et synthétiser des senteurs artificielles en utilisant la chimie des parfums 

      Article Using Flavor Chemistry To Design and Synthesize Artificial Scents and Flavors Jessica L. Epstein, Michael Castaldi, Grishma Patel, Peter Telidecki, and Kevin Karakkatt, J. Chem. Educ., 2015, 92 (5), pp 954–957 DOI: 10.1021/ed500615a résumé de G.D. 2015-2016
    • biblio-10.1021-ed500658splugin-autotooltip__default plugin-autotooltip_bigImplémentation d’une séquence didactique sur la loi de l’équilibre chimique à l'intention d'élèves du secondaire

      Article Implementing an Equilibrium Law Teaching Sequence for Secondary School Students To Learn Chemical Equilibrium Marco Ghirardi, Fabio Marchetti, Claudio Pettinari, Alberto Regis, and Ezio Roletto, J. Chem. Educ., 2015, 92 (6), pp 1008–1015 DOI: 10.1021/ed500658s Résumé de C.M. 2015-2016$\frac{[C]^x[D]^y}{[A]^m[B]^n} = \frac{k_{directe}}{k_{inverse}} = K_{eq}$
    • biblio-10.1021-ed500743rplugin-autotooltip__default plugin-autotooltip_bigL’importance de la métastabilité cinétique: quelques exemples communs

      Article The Importance of Kinetic Metastability: Some Common Everyday Examples William B. Jensen, J. Chem. Educ., 2015, 92 (4), pp 649–654 DOI: 10.1021/ed500743r résumé de G.V. 2015-2016

      Introduction

      Les manuels de thermodynamiques sont susceptibles de laisser aux étudiants une impression erronée car ils indiquent que la seule exigence pour qu’une réaction chimique spontanée thermodynamiquement se produise est une valeur …
    • biblio-10.1021-ed500891wplugin-autotooltip__default plugin-autotooltip_bigComprendre la relation entre les concepts d’Arrhénius, de Bronsted-Lowry et de Lewis

      Article Understanding the Relationship Among Arrhenius, Brønsted–Lowry, and Lewis Theories Seoung-Hey Paik, J. Chem. Educ., 2015, 92 (9), pp 1484–1489 DOI: 10.1021/ed500891w résumé de S.G. 2015-2016

      Introduction

      Il existe de nombreux problèmes dans l’apprentissage par les élèves des concepts d’acide et de base. Ceux – ci sont notamment causés par la description utilisée par les manuels scolaires. En effet, …
    • biblio-10.1021-ed900002dplugin-autotooltip__default plugin-autotooltip_bigPerpectives sur les travaux pratiques dans les études supérieures : objectifs et obstacles à leur efficacité

      Faculty Perspectives of Undergraduate Chemistry Laboratory: Goals and Obstacles to Success, Laura B. Bruck and Marcy Towns, Journal of Chemical Education, Vol. 87 No. 12, pp 1416-1424 - December 2010. Résumé de M.R., 2010-2011.
    • biblio-10.1021-ed2001957plugin-autotooltip__default plugin-autotooltip_bigL'unité de masse atomique, la constante d'Avogadro et la mole : un moyen de comprendre

      The Atomic Mass Unit, the Avogadro Constant, and the Mole: A Way To Understanding, Andrzej Baranski, J. Chem. Educ. 2012, 89, 97-102. DOI: 10.1021/ed2001957 Résumé de B.V.A., 2011-2012.

      Le problème

      L’apprentissage des concepts chimiques de base que sont l’unité de masse atomique ou la mole de constituants sont complexes, car les concepts sous-jacents sont sujets à confusion. Ainsi, les définitions existan…
    • biblio-10.1021-ed3002336plugin-autotooltip__default plugin-autotooltip_bigApprendre le concept d’équilibre chimique aux élèves de secondaire

      A Teaching Sequence for Learning the Concept of Chemical Equilibrium in Secondary School Education Marco Ghirardi, Fabio Marchetti, Claudio Pettinari, Alberto Regis, and Ezio Roletto, J. Chem. Educ., 2014, 91 (1), pp 59–65 DOI: 10.1021/ed3002336 résumé de J.V. 2014-2015
    • biblio-10.1021-ed3004275plugin-autotooltip__default plugin-autotooltip_bigQue veulent dire les chimistes lorsqu'ils parlent des éléments ?

      What Do Chemists Mean When They Talk about Elements? Elena Ghibaudi, Alberto Regis, and Ezio Roletto, J. Chem. Educ., 2013, 90 (12), pp 1626–1631 DOI: 10.1021/ed3004275

      * Certaines incohérences dans la définition de l'élément se retrouvent dans les manuels scolaires et et universitaires, entretenant une confusion entre le concept d'élément et le concept de substance simple, et posant un problème didactique
    • biblio-10.1021-ed3004462plugin-autotooltip__default plugin-autotooltip_bigDoigts les plus rapides: un jeu de construction de molécules pour l'enseignement de la chimie organique

      Fastest Fingers: A Molecule-Building Game for Teaching Organic Chemistry Michael L. Eastwood, J. Chem. Educ., 2013, 90 (8), pp 1038–1041 DOI: 10.1021/ed3004462 Résumé de T.F. 2013-2014

      Enseigner la chimie organique à des élèves débutants n’est pas une chose facile. En tant que des futurs enseignants, nous serons confronté à ce genre de situation et il nous reviendra de droit d’apporter que…
    • biblio-10.1021-ed4003578plugin-autotooltip__default plugin-autotooltip_bigLes perceptions des élèves concernant l'utilisation de jeux éducatifs comme outil pour enseigner le tableau périodique des éléments au niveau secondaire

      Articles Students’ Perceptions about the Use of Educational Games as a Tool for Teaching the Periodic Table of Elements at the High School Level Antonio Joaquín Franco-Mariscal, José María Oliva-Martínez, and M. L. Almoraima Gil, J. Chem. Educ., 2015, 92 (2), pp 278–285 DOI: 10.1021/ed4003578 résumé de G.V. 2015-2016
    • biblio-10.1021-ed4005722plugin-autotooltip__default plugin-autotooltip_bigDétermination sur le terrain ou en laboratoire des ions calcium de l'eau de mer

      Field and In-Lab Determination of Ca2+ in Seawater Robin Stoodley, Jose R. Rodriguez Nuñez, and Tessa Bartz, J. Chem. Educ., 2014, 91 (11), pp 1954–1957 DOI: 10.1021/ed4005722 résumé de S.L. 2014-2015

      Cet article nous présente un travail effectué sur le terrain par des étudiants et son intérêt.
    • biblio-10.1021-ed5000197plugin-autotooltip__default plugin-autotooltip_bigIntégration des représentations de particules dans la chimie

      Integrating Particulate Representations into AP Chemistry and Introductory Chemistry Courses Stephen G. Prilliman, J. Chem. Educ., 2014, 91 (9), pp 1291–1298 DOI: 10.1021/ed5000197 résumé de F.M. 2014-2015, numéro spécial de la revue de septembre 2014, special “AP chemistry curriculum framework”
    • biblio-10.1021-ed5001729plugin-autotooltip__default plugin-autotooltip_bigL'oxydation du Fer : Expérimentation, simulation et analyse dans l'introduction de la chimie

      Article The Oxidation of Iron: Experiment, Simulation, and Analysis in Introductory Chemistry Frederic E. Schubert, J. Chem. Educ., 2015, 92 (3), pp 517–520 DOI: 10.1021/ed5001729 résumé de S.G. 2015-2016

      But

      Le but de cet article est de démontrer l'importance de l'oxydation de fer et confronter des données obtenues par expérimentation et par simulation.
    • biblio-10.1021-ed5007162plugin-autotooltip__default plugin-autotooltip_bigEnseigner aux étudiants débutants en chimie les structures de Lewis simples

      Article Teaching Beginning Chemistry Students Simple Lewis Dot Structures Peter Nassiff and Wendy A. Czerwinski, J. Chem. Educ., 2015, 92 (8), pp 1409–1411 DOI: 10.1021/ed5007162 résumé de L.R. 2016-2017

      Introduction

      Les structures de Lewis conduisent à la compréhension de la liaison chimique et permettent à l’étudiant de construire des molécules simples. Les étudiants qui débutent l’étude de la chimie ont souvent …
    • biblio-10.1021ed082p313plugin-autotooltip__default plugin-autotooltip_bigExpériences et réflexions à propos de l'enseignement de la structure atomique via une classe puzzle dans l'enseignement secondaire

      Experiences and Reflections about Teaching Atomic Structure in a Jigsaw Classroom in Lower Secondary School Chemistry Lessons, Ingo Eilks, J. Chem. Ed. 82(2), pp 313-319,2005. Résumé de A.B. 2010-2011. Article d'intérêt didactique

      Introduction
    • biblio-10.1039-a9rp90008jplugin-autotooltip__default plugin-autotooltip_bigDéveloppement de la compréhension qu’ont les étudiants de la notion de transformation chimique

      Developing students' understanding of chemical change: What should we be teaching?, P. Johnson, Chemistry Education: Research and Practice in Europe, 2000, Vol.1, N°1, pp 77-90. DOI: 10.1039/A9RP90008J Résumé de V.B., 2008-2009. (accès gratuit possible via le site de la RSC)
    • biblio-10.1039-b4rp90005gplugin-autotooltip__default plugin-autotooltip_bigAtome et molécule : étude des représentations d'étudiants du secondaire supérieur français

      Atom and molecule: upper secondary school French students' representations in long-term memory(texte intégral disponible), Aytekin Cokelez et Alain Dumon, Chemistry Education Research and Practice, 2005, 6 (3), 119-135) Résumé de A.W., 2006-2007 - Article d'intérêt didactique. (accès gratuit possible via le site de la RSC)
    • biblio-10.1039-b4rp90027hplugin-autotooltip__default plugin-autotooltip_bigLe laboratoire dans l'enseignement de la chimie : trente ans d'expérience avec des développements, de l'implémentation et de la recherche

      The laboratory in chemistry education : thirty years of experience with developments, implementation, and research, Avi Hofstein, Chem. Educ. Res. Pract., 2004, 5, 247-264. Résumé de A.F., 2011-2012. Article d'intérêt didactique
    • biblio-10.1039-b5rp90014jplugin-autotooltip__default plugin-autotooltip_bigCompréhension par les élèves des titrages et des phénomènes acide-base reliés

      High school students’ understanding of titrations and related acid-base phenomena, K. Sheppard, Chemistry Education Research and Practice, 2006, 7 (1), 32-45. Résumé de A.F., 2011-2012.

      L’auteur, K. Sheppard, a voulu mettre en avant les problèmes qui causent l’incompréhension des étudiants face aux phénomènes acide-base qui régissent les titrages. Les causes mises en avant par l’auteur sont l’incompréhension par les …
    • biblio-10.1039-b812416gplugin-autotooltip__default plugin-autotooltip_bigLa chimie des chips

      Learning chemistry and beyond with a lesson plan on potato crisps, which follows a socio-critical and problem-oriented approach to chemistry lessons, Ralf Marks, Stefanie Bertram and Ingo Eilks, Chem. Educ. Res. Pract., 2008, 9, 267-276. Sur base d'un résumé de A. V. V., AESS 2009-2010. (accès gratuit possible via le site de la RSC)

      Le problème

      L’article part d’une étude réalisée en Allemagne. Le constat est le même que partout ailleurs :
    • biblio-10.1039-b908246hplugin-autotooltip__default plugin-autotooltip_bigLes perceptions des enseignants sur l'enseignement des acides et bases dans l'enseignement secondaire suédois

      Teacher’s perceptions of the teaching of acides and bases in Swedish upper secondary schools, Michal Drechsler and Jan Van Driel, Chemistry Education Research and Practice, 2009, 10, 86-96 DOI: 10.1039/B908246H Résumé de L.B., 2010-2011. (accès gratuit possible via le site de la RSC)
    • biblio-10.1039-c0rp90006kplugin-autotooltip__default plugin-autotooltip_bigLes animations peuvent-elles remplacer les méthodes traditionnelles d’enseignement?

      Partie I - préparation et tests

      Can animations effectively substitute for traditional teaching methods? Part I: preparation and testing of materials Roberto Ma. Gregorius, Rhodora Santos, Judith B. Dano and Jose J. Gutierrez Chem. Educ. Res. Pract., 2010,11, 253-261 DOI: 10.1039/C0RP90006K Résumé de E.V., 2011-2012
    • biblio-10.1039-c005464jplugin-autotooltip__default plugin-autotooltip_bigDiagrammes sub-microscopiques générés par les élèves : un outil utile pour enseigner et apprendre les équations chimiques et la stœchiométrie

      Student-generated submicro diagrams: a useful tool for teaching and learning chemical equations and stoichiometry, Bette Davidowitz, Gail Chittleborough and Eileen Murray, Chemistry Education Research and Practice, 2010, 11, 154-164. Résumé de M.R., 2010-2011.
    • biblio-10.1039-c7rp00135eplugin-autotooltip__default plugin-autotooltip_bigÉtudier la cohérence entre et dans les modèles mentaux de l'étudiant pour la structure atomique

      Studying the consistency between and within the student mental models for atomic structure Nikolaos Zarkadis, George Papageorgiou and Dimitrios Stamovlasis, Chem. Educ. Res. Pract., 2017, 18, 893-902, DOI: 10.1039/C7RP00135E Résumé de V.L., 2017-2018 (accès gratuit possible via le site de la RSC)
    • biblio-10.1039_c0rp90007aplugin-autotooltip__default plugin-autotooltip_bigLes animations peuvent-elles remplacer les méthodes traditionnelles d’enseignement?

      Partie II - potentiel pour un apprentissage différencié

      Can animations effectively substitute for traditional teaching methods? Part II: Potential for differentiated learning Roberto Ma. Gregorius, Rhodora Santos, Judith B. Dano and Jose J. Gutierrez Chem. Educ. Res. Pract., 2010,11, 262-266 DOI: 10.1039/C0RP90007A
    • biblio-10.1333-s00897040769aplugin-autotooltip__default plugin-autotooltip_bigDes équilibres acide-base

      * Des équilibres acide-base, Partie 1. Les conceptions et les difficultés les plus importantes des étudiants du secondaire - Acid-base Equilibria, Part I. Upper Secondary Students’ Misconceptions and Difficulties, DEMEROUTI M., KOUSATHANA M, TSAPARLIS G., Chemical Educator, 2004, 9, pp 122-131 * Des équilibres acide-base, partie 2. Effets du niveau de développement mental et du style cognitif sur la compréhension conceptuelle et la capacité de résolution des problè…
    • biblio-10.1333-s00897082114aplugin-autotooltip__default plugin-autotooltip_bigCommunication scientifique : apprendre aux élèves à préparer et effectuer efficacement des présentations orales

      Scientific Communication: Teaching Students to Prepare and Deliver Effective Oral Presentations, Lesley Brown, Chem. Educator 2008, 13, 54–58. Résumé de V.D., 2008-2009

      Tous les étudiants en sciences ont besoin de compétences leur permettant d’effectuer des présentations scientifiques orales. Cet exercice apprend aux élèves à chercher l’information, à l’organiser et à la présenter à …
    • biblio-10.5923-j.jlce.20170501.03plugin-autotooltip__default plugin-autotooltip_bigActivités de chimie du secondaire avec une composante environnementale: Analyse colorimétrique ionique à coût réduit

      Article : High School Chemistry Activities with an Environmental Concern: Cost-Effective Colorimetric Ion Analysis Zahra Arzani and Hassan Hazarkhani, J. Lab. Chem. Educ., 2017, 5(1), pp 9-12 DOI: 10.5923/j.jlce.20170501.03 résumé de F.H. 2017-2018
    • biblio-9780131493926-chap9plugin-autotooltip__default plugin-autotooltip_bigRésolution des problèmes en chimie : pourquoi les élèves ont-ils des problèmes et que peut-on faire pour les aider ?

      Solving Word Problems in Chemistry: Why Do Students Have Difficulties and What Can Be Done to Help?, Diane M. Bunce, chap 9 du “Chemists'guide to effective teaching”, Pearson Prentice Hall 2005. Résumé de E.V., 2011-2012.
    • biblio-9780131493926-chap10plugin-autotooltip__default plugin-autotooltip_bigUne introduction à l'apprentissage en petits groupes

      An Introduction to Small-Group Learning, Melanie M. Cooper, Department of Chemistry, Clemson University. chapitre 10 du “Chemists'guide to effective teaching”, Norbert J. Pienta, Melanie M. Cooper, Thomas J. Greenbowe, Pearson Prentice Hall 2005. Résumé de A.P., 2011-2012.
    • biblio-9780321611956-chap14plugin-autotooltip__default plugin-autotooltip_bigAnimations sur ordinateur de phénomènes chimiques à l'échelle moléculaire

      Chemists' Guide to Effective Teaching, Volume II, Norbert J. Pienta, Melanie M. Cooper & Thomas J. Greenbowe, Prentice Hall, 2008, ISBN 9780321611956 - Chapter 14: Computer Animations of Chemical Processes at the Molecular Level (Résumé de S.P., 2013-2014)
    • biblio-_10.1039-c1rp90056kplugin-autotooltip__default plugin-autotooltip_bigUne étude de la compréhension des étudiants de chimie de première année (ens. sup.) sur la concentration des solutions

      A study of first-year chemistry students’ understanding of solution concentration at the tertiary level, Kevin de Berg, Chem. Educ. Res. Pract., 2012, 13, 8-16. Résumé de A.P., 2011-2012. Article d'intérêt didactique

      Les différents concepts en chimie sont souvent mal compris voir incompris, et provoquent chez les étudiants de nombreuses difficultés à réussir les cours de chim…
    • biblio-ardist2005-64plugin-autotooltip__default plugin-autotooltip_bigPourquoi une transformation chimique s’arrête-t-elle ? Les explications d’élèves de terminale S

      Lien INRP (Actes des quatrièmes rencontres de l’ARDIST, 12-15, Octobre 2005, INRP, Lyon, 193-200. Kermen Isabelle, Laboratoire de Didactique des Sciences Physiques, Université Paris 7, Paris - Résumé de N.S., 2008-2009
    • biblio-didactique-chimieplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes en didactique de la chimie, mais pas seulement

      La plupart des résumés de publications sont issus d'analyses d'articles effectuées par des étudiants dans le cadre des études d'AESS en chimie ou de bacheliers/masters en chimie (les initiales et années sont alors indiquées), pour des publications souvent issues de cette
    • biblio-roxci-arbrandriet-slbretz-umiami-2014plugin-autotooltip__default plugin-autotooltip_bigRedox Concept Inventory (ROXCI)

      Par Alexandra R. Brandriet et Stacey Lowery Bretz, Université de Miami (une thèse et 2 articles) :

      * Investigating Students' Understandings of the Symbolic, Macroscopic, and Particulate Domains of Oxidation-Reduction and the Development of the Redox Concept Inventory, PhD thesis, Brandriet, Alexandra R, 2014, Miami University * The Development of the Redox Concept Inventory as a Measure of Students’ Symbolic and Particulate Redox Understandings and Confidenc…
    • boreplugin-autotooltip__default plugin-autotooltip_bigBore

      FIXME

      * La betterave est très sensible à la carence en cet oligo-éléments (maladie du cœur noir) * * L'élément (atome) apporté est le bore. Il est sous forme acide borique via une substance appelée bore éthanolamine

      * l'acide borique est utilisé pour traiter les conjonctivites (?)
    • carboneplugin-autotooltip__default plugin-autotooltip_bigCarbone

      Diamant

      Graphite

      * fr:Mersen : En 1893, Charles Street, ingénieur chez Le Carbone, découvre et brevète le procédé de la graphitation du carbone qui permet la fabrication de graphite synthétique * En 2019, 9,41 millions de dollars australiens d'aides ont été attribués pour un projet de conversion du biogaz (ici issu de méthanisation de boues d’épuration) en graphite et en hydrogène. (cf.
    • cerp_rssplugin-autotooltip__default plugin-autotooltip_bigChemistry Education Research and Practice : fil RSS des derniers articles

      Chemistry Education Research and Practice : fil RSS des derniers articles
    • conference-brey-20160420plugin-autotooltip__default plugin-autotooltip_bigÀ quoi servent les savoirs scolaires ?

      Conférence de Bernard Rey, Charleroi, avril 2016

      Annonce :

      * Les Cafés Conférences de l’Échevinat de l’enseignement de la Ville de Charleroi, en partenariat avec le Centre de Culture scientifique de l’ULB, l’UAE Charleroi-Le Centre , l’Extension de l’ULB, La Ligue de l’Enseignement et de l’Education permanente et Charleroi Danses proposent une conférence de Bernard Rey, Docteur en Sciences de l’Éducation et Professeur honoraire à l’ULB…
    • connaitre_le_cerveau_pour_mieux_enseigner-stevemasson2016plugin-autotooltip__default plugin-autotooltip_bigConnaître le cerveau pour mieux enseigner

      Adapté de la présentation par Steve Masson (22 septembre 2016, UMONS)

      FIXME : achever

      Principe 1 : Éviter les neuromythes

      * Neuromythes : * Styles d’apprentissage : Les personnes apprennent mieux quand ils reçoivent l’information dans leur style d’apprentissage préféré (auditif, visuel, kinesthésique, etc.)
    • convention_stageplugin-autotooltip__default plugin-autotooltip_bigConvention de stage : modèle et directives

      wiki du service de didactique des disciplines scientifiques * lien direct :
    • cuisine_moleculaireplugin-autotooltip__default plugin-autotooltip_bigLa cuisine moléculaire

      L'alimentation serait à l'origine de nos capacités neuronales plus importantes : cf. Suzana Herculano-Houzel’s TED talk

      Situations d'apprentissage

      * la mayonnaise ratée * l'œuf est très souvent trop cuit : * le jaune devient verdâtre * le jaune est trop sec
    • cuivreplugin-autotooltip__default plugin-autotooltip_bigCuivre

      Patine du cuivre exposé aux conditions atmosphériques

      * * * * * *
    • desinformationsplugin-autotooltip__default plugin-autotooltip_bigDes informations ou désinformations ?

      Cette page regroupe quelques exemples d'informations et désinformations, notamment tirés de différents media : presse, réseaux sociaux, blogs, forums,... des désinformations, et parfois aussi une information qui se veut plus conforme aux faits.
    • didactiquechimieplugin-autotooltip__default plugin-autotooltip_bigDidactique de la chimie

      Cours, exercices et stages :

      * Séminaire de méthodologie spéciale en chimie (agrégation en chimie, 45 H cours et 15 H TP + masters chimie à finalité didactique) * Séminaires de méthodologie spéciale de la chimie (agrégation en biologie, 15 H cours + masters BOE & BBMC à finalité didactique) * Micro-enseignement et analyse des pratiques pédagogiques (20 H) *
    • dosage_titrationplugin-autotooltip__default plugin-autotooltip_bigDosage et titration

      FIXME : à formater et illustrer. Ajouter des liens

      Introduction

      Le but de cette manipulation est de vous familiariser avec la technique de dosage ou titrage d'acides ou de bases. Pour cela, il est indispensable :

      * de connaître l'utilisation de chaque élément de la verrerie mise à votre disposition
    • efficacite_energetique_transportplugin-autotooltip__default plugin-autotooltip_bigEfficacité énergétique des transports

      Vocabulaire, généralités

      * Metabolic cost of transport * Cost of transport * Efficacité énergétique dans les transports * Energy efficiency in transport * Animal locomotion * Exercise Physiology * Energy * Human Performance * nutritional efficiency

      Références

      Humain :

      * The mechanics and energetics of human walking and running: a joint level perspective Dominic James Farris and Gregory S. SawickiJ R Soc Interface. 2012 Jan 7; 9(66): …
    • ethanolplugin-autotooltip__default plugin-autotooltip_bigEthanol, éthanol

      * The Chemistry of a Hangover, 01/01/2016
    • etudes-aessplugin-autotooltip__default plugin-autotooltip_bigGénéralités sur l'agrégation et les masters à finalité didactique en Faculté des Sciences

      wiki du service de didactique des disciplines scientifiques * lien direct :
    • etudes-capaesplugin-autotooltip__default plugin-autotooltip_bigGénéralités sur le CAPAES

      Le Certificat d'Aptitude Pédagogique Approprié à l'Enseignement Supérieur concerne les enseignants en haute école. Cet emploi est nécessaire pour pouvoir s'y inscrire.

      La Communauté française pour les établissements qu'elle organise et tout pouvoir organisateur poursuivent comme objectif dans l'organisation du CAPAES d'amener les maîtres de formation pratique, les maîtres assistants et les chargés de cours recrutés dans une haute école, qui s'y inscrivent à développer…
    • etudes-master_chimie_fd-presentationplugin-autotooltip__default plugin-autotooltip_bigMaster chimie à finalité didactique

      Présentation de la finalité didactique, à l'intention des étudiants terminant le cycle de bachelier



      Cadre général

      * 30 crédits spécifiques = AESS chimie * Prépare au métier d’enseignant dans l’enseignement secondaire
    • exos-chimieplugin-autotooltip__default plugin-autotooltip_bigExercices scolaires ("Exos") de chimie

      Divers exercices de chimie ayant certaines des caractéristiques suivantes :

      * originalité, attractivité * liaison à l'actualité, à un ou des problèmes de société * un intérêt historique, ou sur l'histoire des sciences
    • exos_batterie_capacite_densiteplugin-autotooltip__default plugin-autotooltip_bigQuelles tailles et capacités de batteries électriques pour assurer l'utilisation d'énergies renouvelables

      Le stockage énergétique est nécessaire dans le cadre d'une transition vers 100% d'énergie renouvelable. Si l'énergie hydroélectrique peut être utilisée à volonté (pilotable), ce n'est pas le cas des productions d'électricité via les éoliennes et les panneaux photo-voltaïques qui sont de plus en plus installés.
    • exos_comment_equilibrer_des_redox_complexesplugin-autotooltip__default plugin-autotooltip_bigComment équilibrer des réactions redox complexes

      * Sources : * Chemistry Stackexchange : How to balance more complex redox reactions? * contribution de A.-C. N., étudiante AESS 2018-2019

      Équation redox compliquée non équilibrée:

      (s)+(aq) → (aq)+(g)+

      Procédure à suivre:
    • exos_crema_di_limoncello_della_camorraplugin-autotooltip__default plugin-autotooltip_bigRecette de la "Crema di Limoncello della Camorra"

      Bella Simone, brillante avocate de Palerme, a défendu en octobre 2004 Luciano Ferretti, un “parrain de la Camorra”, lui permettant d'échapper à la prison. Par reconnaissance, celui-ci lui révéla sur son lit de mort la recette familiale de la
    • exos_empreinte_carboneplugin-autotooltip__default plugin-autotooltip_bigExercices sur l'empreinte carbone

      FIXME : Carbon footprint

      * Empreinte carbone * Carbon footprint * Tonne of oil equivalent * Tonne of coal equivalent * * * * * * Émission de dioxyde de carbone

      Références académiques :

      * Towards a univ…
    • exos_enduit_chauxplugin-autotooltip__default plugin-autotooltip_bigEnduits à la chaux

      * Chaux (matière)

      Enduits "naturels" argile-chaux

      * Déterminer le composition * Quel est le bilan carbone si on suppose utiliser des hydrocarbures fossiles pour la production de la chaux * Comparer au plâtre

      Références

      * fr:Plâtre
    • exos_energie_d_ionisationplugin-autotooltip__default plugin-autotooltip_bigÉnergie d'ionisation

      Voir aussi :

      * Glossaire : ionisation (énergie d') * Énergie d'ionisation * Liste d'énergies d'ionisation

      Pourquoi l'énergie d'ionisation diminue-t-elle lorsque la taille de l'atome augmente

      * Why does the ionization energy decrease anytime the atom size increases?

      Graphique

      Code Python :

      from mendeleev import element import matplotlib.pyplot as plt

      x, y = range(1,108), [element(i).ionenergies[1] for i in range(1,108)] for i in range(1,108): print(x[i-…
    • exos_les_acides_donnent_ils_vraiment_un_protonplugin-autotooltip__default plugin-autotooltip_bigLes acides donnent-ils vraiment un proton ?

      * Cf. chemistry.stackexchange : Do acids really donate a proton? * Question gérée par S.N., étudiant 2019-2020

      Développement

      (lignes de développement uniquement - ici figurent qques mots clefs et symboles de type (..) pour définir les lignes directrices de l'argumentaire/l'explication)
    • exos_pourquoi_l_energie_d_ionisation_diminue_t_elle_lorsque_la_taille_de_l_atome_augmenteplugin-autotooltip__default plugin-autotooltip_bigPourquoi l'énergie d'ionisation diminue-t-elle lorsque la taille de l'atome augmente ?

      * Cf. chemistry.stackexchange : Why does the ionization energy decrease anytime the atom size increases? * Question gérée par S.C. 2019-2020

      L'énergie d'ionisation (EI) correspond à l'énergie qu'il faut appliquer pour arracher un électron à un atome. Le rayon atomique des atomes influence cette énergie d'ionisation de manière inversement proportionnelle.$1s^2 2s^2$$1s^2 2s^2 2p^1$
    • exos_pourquoi_la_phenolphtaleine_est_un_indicateur_approprie_pour_le_titrage_d_un_acide_fort_par_une_base_forteplugin-autotooltip__default plugin-autotooltip_bigPourquoi la phénolphtaléine est un indicateur approprié pour le titrage d'un acide fort par une base forte ?

      * Sources : * Chemistry Stackexchange : Why is phenolphthalein an appropriate indicator for titration of a strong acid with a strong base ? * contribution de E.F., étudiant AESS 2018-2019

      La phénolphtaléine est incolore en dessous d'un pH de 8,2 et devient couleur
    • exos_pourquoi_le_borax_est_il_utilise_comme_standard_primaireplugin-autotooltip__default plugin-autotooltip_bigPourquoi le borax est-il utilisé comme standard primaire

      * Sources : * Chemistry Stackexchange : Why is Borax used as a primary standard? * contribution de E.D., étudiant AESS 2018-2019 * fr:Borax

      Qu’est-ce que le borax ?

      Les borates sont des composés chimiques constitués d’atomes de bore et d’oxygène. Le borax est le nom communément utilisé pour le borate de sodium hydraté de formule brute :
    • exos_pourquoi_les_sels_tels_que_le_nacl_se_dissolvent_dans_l_eauplugin-autotooltip__default plugin-autotooltip_bigPourquoi les sels tels que le NaCl se dissolvent dans l'eau ?

      * Cf. chemistry.stackexchange : Why do salts such as NaCl dissolve? * Question gérée par L.G. 2019-2020

      Contexte

      Début du cours sur la solvatation, 3ème degré du secondaire en sciences générales.

      Deux paramètres à prendre en compte :
    • exos_quel_volume_occupe_une_mole_de_gaz_idealplugin-autotooltip__default plugin-autotooltip_bigQuel volume occupe une mole de gaz idéal ?

      * Sources * What volume does one mole of an ideal gas occupy? * contribution de E.K., étudiante AESS 2018-2019 * Socratic Q&A Chemistry : What causes gas pressure (in terms of kinetic theory)?

      Avant de répondre à cette question, il serait nécessaire de définir un gaz idéal, encore appelé « gaz parfait ». Les gaz doivent répondre à deux conditions afin d’être définis comme parfait.
    • ferplugin-autotooltip__default plugin-autotooltip_bigFer

      FIXME

      * Le soudage exothermique, également appelé soudage aluminothermique, est un procédé de soudage qui utilise du métal en fusion pour relier de manière permanente les conducteurs. La poussière d'aluminium réduit l'oxyde d'un autre métal, le plus souvent l'oxyde de fer : Fe₂O₃ + 2Al → 2Fe + Al₂O₃
    • glossaire-chimieplugin-autotooltip__default plugin-autotooltip_bigGlossaire de termes usuels de chimie

      Ce glossaire reprend principalement les termes chimiques utilisés dans le cours de chimie de l'enseignement secondaire belge (cf. les unités d'acquis d'apprentissage de chimie en sciences générales). Le niveau des définitions est adapté au niveau d'étude. L'ensemble est placé sous licence libre $\chi_{A}$
    • glucidesplugin-autotooltip__default plugin-autotooltip_bigGlucides

      FIXME

      * équivalent chimique simplifié (glucose, fructose,...) * conversion énergie, stœchiométrie avec H2O, O2, CO2,... * limites théoriques de la photosynthèse * production, consommation

      Références

      * The Dose Makes the Poison: Sugar and Obesity in the United States – a Review Samir Faruque, Janice Tong, Vuk Lacmanovic, Christiana Agbonghae, Dulce M. Minaya, and Krzysztof Czaja, Pol J Food Nutr Sci. 2019; 69(3): 219–233. DOI: 10.31883/pjfns/110735
    • hcq-20200523plugin-autotooltip__default plugin-autotooltip_bigHCQ 23 mai 2020

      * → fin de partie

      ⛔ Chloroquine à la Marseillaise : fin de partie ! ⛔

      [⚠ Avertissement : ceci est un long article qui ne cherche pas à vous faire croire mais tentera d’expliquer et, en toute fin, de lister des ressources pour aller vérifier par vous-mêmes les données scientifiques et pas celle de Gérard, médecin épidémiologiste depuis 3 jours après formation Doctissimo ⚠]
    • heliumplugin-autotooltip__default plugin-autotooltip_bigHélium

      * Hélium * Helium

      Références

      * Nothing on Earth Can Replace Helium — and It’s in Peril The New York Times 04/09/2019
    • hydrogeneplugin-autotooltip__default plugin-autotooltip_bigHydrogène

      FIXME

      * Utilisation du dihydrogène * pile à combustible * électrolyse * Stockage de l'hydrogène, par compression (jusque 700 bar), liquéfaction (T < 20 kelvin), formation d'hydrures métalliques,... * utilisation comme gaz courant transporté dans des conduites
    • images_chimie_libresplugin-autotooltip__default plugin-autotooltip_bigImages libres en chimie

      * N'oubliez pas de respecter les licences (sauf domaine public ou licence CC-zero), cf. les explications à la page Ressources éducatives libres. Voir en particulier les sources mentionnées ici : Images libres * Plutôt que de copier l'image, surfez vers le lien afin de sélectionner la résolution qui vous convient
    • informatiqueplugin-autotooltip__default plugin-autotooltip_bigInformatique appliquée (programmation, méthodes numériques,...)

      Cours, exercices et stages :

      * Programmation appliquée à la chimie (bachelier en sciences chimiques, deuxième année, 15 H cours et 15 H exercices) * Calculation methods applied to chemistry / Méthodes de calcul appliqué à la chimie (1er et 2ème master en sciences chimiques, 15 H cours et 15 H TP, en option)
    • initinfoplugin-autotooltip__default plugin-autotooltip_bigInitiation à l'informatique

      Cours libre en ligne à destination des étudiants de la section chimie. Si vous avez des questions ou souhaits de compléments d'informations, ou d'ajouts de rubriques, vous pouvez utiliser ce formulaire de contact.

      Les bases de l'informatique
    • jchemed_rssplugin-autotooltip__default plugin-autotooltip_bigFil RSS des derniers articles parus dans Journal of Chemical Education

      Fil RSS des derniers articles parus dans Journal of Chemical Education
    • lithiumplugin-autotooltip__default plugin-autotooltip_bigLithium

      À compléter

      * piles, batteries + incendie, explosion,...
    • luminolplugin-autotooltip__default plugin-autotooltip_bigLuminol

      Le fer contenu dans des traces de sang (hémoglobine) joue le rôle de catalyseur dans la réaction du luminol avec l'eau oxygénée (peroxyde d'hydrogène), qui dégage alors rapidement l'énergie libérée par la réaction en émettent une lumière bleue. c'est de la chimiluminescence.
    • magnesiumplugin-autotooltip__default plugin-autotooltip_bigMagnésium

      FIXME : à compléter

      * divers * Sulfate de magnésium, sel d'Epsom (heptahydrate de sulfate de magnésium) et sel anhydre d'Epsom, dont l'obtention peut être constatée via une perte en eau (diminution de la masse) * Talc : silicate de magnésium doublement hydroxylé :
    • mercureplugin-autotooltip__default plugin-autotooltip_bigMercure

      FIXME

      * Spiraling 'demon' reaction
    • micro-enseignementplugin-autotooltip__default plugin-autotooltip_bigPage déplacée ici :
    • mineralogie-geologieplugin-autotooltip__default plugin-autotooltip_bigMinéralogie - Géologie - Roches - Minerais

      * fr:Portail:Minéraux_et_roches * fr:Roche : magmatiques, sédimentaires, métamorphiques * Rock (geology) * Igneous rock * Sedimentary rock * Metamorphic rock * Granite * Granodiorite * Diorite * Basalt * Dolérite

      * Ultramafic rock (ultrabasic rock) * Shale (schiste) * Sandstone (grès) * Limestone (calcaire)

      Pistes didactiques

      * composition chimique du sous-sol et nécessité d'amender pour l'agriculture
    • orplugin-autotooltip__default plugin-autotooltip_bigOr

      * fr:Or * Gold

      Objets en or

      * America_(toilet) * * vol le 14/09/2019 * *
    • oxygeneplugin-autotooltip__default plugin-autotooltip_bigOxygène

      FIXME

      Cycle global

      * (océan ou Amazonie “poumon” de la terre ?) : Le dioxygène, dont la concentration est d’environ 200 000 ppm, a diminué de 80 ppm en 20 ans ! Sur la même période, le CO2 a augmenté d’un peu moins de 40 ppm.
    • palladiumplugin-autotooltip__default plugin-autotooltip_bigPalladium

      FIXME : à compléter

      Media

      * Catalyst made from plant roots promotes Suzuki reaction : Researchers in France have produced an active palladium catalyst from the roots of plants grown in contaminated water.
    • physicochimieplugin-autotooltip__default plugin-autotooltip_bigActivités d'enseignement en chimie-physique

      Cours, exercices et stages :

      * Thermodynamique (bachelier en sciences chimiques, deuxième année, 30 H cours, 30 H exercices et 30 H travaux pratiques, en co-suppléance avec P. Damman et S. Gabriele)
    • physicochimie_1plugin-autotooltip__default plugin-autotooltip_bigPhysicoChimie I

      Bachelier en sciences chimiques, deuxième année, 30 H cours et 30 H travaux pratiques, en co-suppléance avec P. Damman et S. Gabriele)

      FIXME : contenus à ajouter sur la partie “phénomènes de transport”.

      Références

      *
    • plombplugin-autotooltip__default plugin-autotooltip_bigPlomb

      FIXME

      Tension de vapeur du plomb

      Bien que réputé toxique, le plomb a une tension de vapeur très faible, qui a été difficile à mesurer :

      * The vapour pressure of lead.—I Alfred Charles Egerton, published 01 June 1923 DOI: 10.1098/rspa.1923.0071

      Recyclage des batteries au plomb
    • plutoniumplugin-autotooltip__default plugin-autotooltip_bigPlutonium

      Stabilité chimique

      * A new stable form of plutonium discovered at the ESRF 18/10/2019 * A new stable form of plutonium discovered at the ESRF * A novel meta‐stable pentavalent plutonium solid phase on the pathway from aqueous Pu(VI) to PuO2 nanoparticles - Kvashnina - - Angewandte Chemie International Edition - Wiley Online Library Kvashnina K. O. et al, Angewandte Chemie, DOI: 10.1002/anie.201911637
    • protoxyde_azoteplugin-autotooltip__default plugin-autotooltip_bigProtoxyde d'azote

      * Protoxyde d’azote * Nitrous oxide * Nitrous oxide - pubchem * Nitrous oxide FAQ

      Utilisation grand public : dans les siphons pour crème chantilly, espumas

      lien

      Usage comme drogue

      lien : Detail from a satirical print from 1830 depicting Humphry Davy administering a dose of Laughing Gas to a woman while Count Rumford looks on (cropped out of the picture above), above the caption
    • psychologie_de_l_educationplugin-autotooltip__default plugin-autotooltip_bigPsychologie de l'éducation

      Thèmatiques reliées : neurosciences, cognition/métacognition, motivation,...

      Principes fondamentaux

      * Comment pensent et apprennent les élèves ? * PRINCIPE 1 - Les convictions et perceptions de l’élève sur son intelligence et ses aptitudes influencent son mode de fonctionnement cognitif et son apprentissage.
    • publis_diversesplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes

      Dans Journal of Chemical Education

      2020

      FIXME

      2019

      * Total Chemical Footprint of an Experiment: A Systems Thinking Approach to Teaching Rovibrational Spectroscopy Paul D. Cooper, Jacob Walser, J. Chem. Educ. 2019, 96(12), 2947-2951 DOI: 10.1021/acs.jchemed.9b00405 * Valorization of Waste Orange Peel to Produce Shear-Thinning Gels Lucy S. Mackenzie, Helen Tyrrell, Robert Thomas, Avtar S. Matharu, James H. Clark, Glenn A. Hurst, J. Chem. Educ. 2019, 96(12), 3025…
    • qui_a_invente_l_eau_chaudeplugin-autotooltip__default plugin-autotooltip_bigQui a inventé l'eau chaude

      Peut-être un cuisinier ?

      Atelier autour de la calorimétrie dans une cuisine

      Introduction

      La cuisson des aliments permet à l'homme de mieux s'alimenter. L'eau est le milieu le plus largement utilisé pour cuire nos pâtes, légumes, riz, œufs,$m$$c$$T_i$$T_f$$Q = m c (T_f - T_i)$$m$$\Delta H_f$$Q = m \Delta H_f$
    • quoraplugin-autotooltip__default plugin-autotooltip_bigQuora

      * What ALL are EXCEPTIONS in chemical BONDING? * ...
    • reactions_chimiquesplugin-autotooltip__default plugin-autotooltip_bigThermodynamique et réactions chimiques

      Source de données

      * Tables incluant des données utiles pour les réactions : * * * *

      Les pages Wikipédia des substances reprennent aussi des données utilisables.
    • reglementaessplugin-autotooltip__default plugin-autotooltip_bigPage déplacée ici :
    • ressourceschimieplugin-autotooltip__default plugin-autotooltip_bigRessources en enseignement de la chimie

      * Unités d’acquis d’apprentissage * Vue globale des programmes : * Sciences générales - Tableau synoptique de chimie - FWB * Sciences de base - Tableau synoptique de chimie - FWB * Tableaux synoptiques du SEGEC (enseignement catholique)

      * Glossaire de termes usuels en chimie * Ligne du temps de la chimie * Sélection d'articles en didactique de la chimie * Publications intéressantes (résumés)

      * Des informations ou désinformation…
    • rss-chimieplugin-autotooltip__default plugin-autotooltip_bigFils RSS

      * Cliquez pour savoir ce qu'est un fil RSS * Consultez le code source de cette page pour obtenir les liens RSS

      Compound Interest

      éduscol physique-chimie

      pour la classe de cinquième

      pour la classe de quatrième

      pour la classe de troisième
    • sciences_de_base_tableau_synoptique_fwbplugin-autotooltip__default plugin-autotooltip_bigSciences de base - Tableau synoptique de chimie - FWB

      Les indications proposées des nombres de périodes le sont pour les sous-titres et sous-sous-titres énoncés jusqu'à l'indication suivante. Pour chaque unité d'acquis d'apprentissage, il est souvent proposé de consacrer une période à des évaluations formatives et une période à l'évaluation sommative, et parois un peu moins ou un peu plus.
    • sciences_generales_tableau_synoptique_fwbplugin-autotooltip__default plugin-autotooltip_bigSciences générales - Tableau synoptique de chimie - FWB

      Les indications proposées des nombres de périodes le sont pour les sous-titres et sous-sous-titres énoncés jusqu'à l'indication suivante. Pour chaque unité d'acquis d'apprentissage, il est souvent proposé de consacrer une période à des évaluations formatives et une période à l'évaluation sommative. Mais par exemple pour l'uaa 6 ce sera deux fois une demi période, tandis que pour l'uaa 10, les durées d'évaluation sont de deux périodes.…
    • stackexchange-chimieplugin-autotooltip__default plugin-autotooltip_bigQuestions et réponses en chimie sur chemistry.stackexchange

      Chemistry Stack Exchange est un site de questions et réponses pour les scientifiques, les enseignants, les étudiants,... Il est gratuit, est son contenu est sous licence libre (copyleft) Creative Commons BY-SA. Aucune inscription n'est requise pour la consultation. Vous devez vous identifier pour y contribuer. Le fonctionnement est réglé par un système de
    • tableaux_synoptiques_segec_2017plugin-autotooltip__default plugin-autotooltip_bigTableaux synoptiques du SEGEC (2017)

      Pour les sciences, et en particulier la chimie, le SEGEC (enseignement catholique) propose des tableaux synoptiques de ses programmes. Lien direct :

      Sciences de base

      Tableau synoptique de chimie

      * 1er degré
    • teaching_ressources_videosplugin-autotooltip__default plugin-autotooltip_bigRessources pour la création de séquences vidéos et l'enseignement à distance

      Conseils généraux pour la conception

      * conseils, longueurs, styles,... * Planifier, réaliser et diffuser des vidéos éducatives : lignes directrices et astuces pour les enseignants, Caroline Cormier, Edward Awad, Yann Brouillette et Véronique Turcotte (canada). Article reprenant des exemples de capsule en chimie
    • terminologie-enseignementplugin-autotooltip__default plugin-autotooltip_bigTerminologie utilisée dans l'enseignement

      Lexique

      Agrégation de l'enseignement secondaire inférieur ou régendat

      études conduisant à l'obtention du grade d'agrégé de l'enseignement secondaire inférieur

      Agrégation de l'enseignement secondaire inférieur
    • testplugin-autotooltip__default plugin-autotooltip_bigtest

      test
    • timeline-chimieplugin-autotooltip__default plugin-autotooltip_bigLigne du Temps de la Chimie

      Préambule

      Toute science progresse par la réalisation et l'interprétation d'expériences, par l'introduction de nouveaux concepts, ... Des améliorations et corrections se succèdent alors, dévoilant parfois des erreurs ou des imprécisions du passé. Dans de nombreuses situations, la recherche scientifique induit des interrogations sur l'articulation des travaux actuels par rapport à la masse des connaissances précédentes. Dès lors, on se rend compte qu'une connaissanc…
    • uaa-chim-sb-01-matiereplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 1 – Deuxième degré

      Constitution et classification de la matière

      Compétences à développer

      * Décrire et modéliser les différents niveaux d’organisation de la matière * Analyser le tableau périodique des éléments pour en extraire des informations pertinentes
    • uaa-chim-sb-02-reaction-chimique-qualitativeplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 2 – Deuxième degré

      La réaction chimique : approche qualitative

      Compétences à développer

      * Réaction chimique * A partir de l’observation d’un phénomène chimique, décrire le réarrangement moléculaire et traduire la réaction chimique par une équation pondérée
    • uaa-chim-sb-03-reaction-chimique-quantitativeplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 3 – Deuxième degré

      La réaction chimique : approche quantitative

      Compétences à développer

      * Résoudre des problèmes de stœchiométrie dans le cas de réactions complètes avec les réactifs en quantités stœchiométriques. 
    • uaa-chim-sb-04-caracteriser-phenomene-chimiqueplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 4 – Deuxième degré

      Caractériser un phénomène chimique

      Compétences à développer

      * Classer les phénomènes selon l’effet thermique associé (exothermique, endothermique, athermique) * Caractériser la vitesse de réaction sur base de critères qualitatifs
    • uaa-chim-sb-05-liaisonsplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 5 – Troisième degré

      Les Liaisons chimiques

      Compétences à développer

      * A partir du modèle de Lewis et d’informations du tableau périodique des éléments, représenter une molécule avec ses liaisons
    • uaa-chim-sb-06-equilibres-chimiquesplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 6 – Troisième degré

      Les équilibres chimiques

      Compétences à développer

      * Prévoir le sens d’évolution d’une réaction réversible

      Processus

      Appliquer

      * Utiliser une table des constantes d’équilibre pour distinguer une réaction complète d’une réaction limitée à un équilibre
    • uaa-chim-sb-07-chimie-organiqueplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 7 – Troisième degré

      Notions de base de chimie organique (alcanes, polymères, alcènes)

      Compétences à développer

      * Evaluer l’importance des substances organiques dans l’environnement quotidien du consommateur responsable
    • uaa-chim-sb-08-grandes-classes-reactions-chimiquesplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 8 – Troisième degré

      Grandes classes de réactions chimiques (acide-base, oxydoréduction, précipitation)

      Compétences à développer

      * Décrire une réaction de précipitation comme une réaction de recombinaison d’ions, une réaction acide base comme un transfert de protons, une oxydoréduction comme un transfert d’électrons
    • uaa-chim-sg-01-matiereplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 1 – Deuxième degré

      Constitution et classification de la matière

      Compétences à développer

      * Décrire et modéliser les différents niveaux d’organisation de la matière. * Analyser le tableau périodique des éléments pour en extraire des informations pertinentes.
    • uaa-chim-sg-02-reaction-chimique-qualitativeplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 2 – Deuxième degré

      La réaction chimique : approche qualitative

      Compétences à développer

      * Réaction chimique * A partir de l’observation d’un phénomène chimique, décrire le réarrangement moléculaire et traduire la réaction chimique par une équation pondérée.
    • uaa-chim-sg-03-reaction-chimique-quantitativeplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 3 – Deuxième degré

      La réaction chimique : approche quantitative

      Compétences à développer

      * Déterminer expérimentalement les coefficients stœchiométriques d’une réaction complète. * Résoudre des problèmes de stœchiométrie dans le cas de réactions complètes.
    • uaa-chim-sg-04-identifierplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 4 – Deuxième degré

      Identifier une espèce chimique par une réaction chimique

      Compétences à développer

      * Identifier expérimentalement l’oxygène, l’hydrogène, le dioxyde de carbone, des ions à l’aide de réactions de précipitation.
    • uaa-chim-sg-05-liaisonsplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 5 – Troisième degré

      Liaisons chimiques et configuration spatiale des espèces chimiques

      Compétences à développer

      * A partir du modèle de Lewis et d’informations du tableau périodique des éléments, représenter une molécule avec ses liaisons.
    • uaa-chim-sg-06-caracteriser-phenomene-chimiqueplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 6 – Troisième degré

      Caractériser un phénomène chimique

      Compétences à développer

      * Caractériser la vitesse de réaction sur base de critères qualitatifs * Caractériser l’effet thermique d’un phénomène chimique
    • uaa-chim-sg-07-equilibres-chimiquesplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 7 – Troisième degré

      Les équilibres chimiques

      Compétences à développer

      * Prévoir le sens d’évolution d’une réaction réversible * Résoudre des problèmes d’équilibre chimique.

      Processus
    • uaa-chim-sg-08-molecule-chimie-organiqueplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 8 – Troisième degré

      La molécule en chimie organique

      Compétences à développer

      * Evaluer l’importance des substances organiques dans l’environnement quotidien du consommateur responsable. * Décrire des spécificités de la chimie du carbone
    • uaa-chim-sg-09-macromolecule-chimie-organiqueplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 9 – Troisième degré

      La macromolécule en chimie organique

      Compétences à développer

      * Evaluer l’importance des macromolécules dans notre environnement.

      Processus

      Appliquer

      Transférer

      * Mener une recherche permettant de classer les polymères selon leurs propriétés physiques (par exemple : thermoplastique, thermodurcissable, élastomère,
    • uaa-chim-sg-10-reactions-avec-transfert-acide-base-oxydoreductionplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 10 – Troisième degré

      Les réactions avec transfert : les réactions acide-base et d’oxydoréduction

      Compétences à développer

      * Décrire, expliquer et prévoir un phénomène chimique relevant d’une réaction de transfert à l’aide de modèles scientifiques.
    • unites_acquis_apprentissagesplugin-autotooltip__default plugin-autotooltip_bigLes unités d’acquis d’apprentissage

      L'objectif de cette page est de présenter sous forme de texte électronique cherchable les référentiels “UAA” de chimie dans l'enseignement secondaire (général et technique de transition ou qualification).
    • uraniumplugin-autotooltip__default plugin-autotooltip_bigUranium

      FIXME : composés “courants” avec de l'uranium (verrerie),...

      * fr:Uranium * fr:Catégorie:Composé_de_l'uranium

      Références :

      * A Marine‐Inspired Hybrid Sponge for Highly Efficient Uranium Extraction from Seawater Advanced Functional Materials, may 2019 DOI: 10.1002/adfm.201901009 * Alerte : de l’uranium radioactif dans nos assiettes ! avec quelques ordres de grandeur intéressants * En Belgique (cartographie) :
    • videos_chimie_sgplugin-autotooltip__default plugin-autotooltip_bigVidéos pour le cours de chimie sciences générales





      Cette page reprend des références de vidéos utilisables dans un cours de chimie “Sciences générales”, suivant le programme du réseau officiel de la FWB. Ces vidéos sont évidemment tout aussi exploitables pour un autre cours de chimie (autre programme, sciences …
    • vulgarisationplugin-autotooltip__default plugin-autotooltip_bigActivités de vulgarisation et diffusion du savoir scientifique

      Cours préparatoires

      Manipulations, démonstrations

      * Dosage et titration, TP “classique” de chimie sur les réactions acide-base * Qui a inventé l'eau chaude, atelier autour de la calorimétrie dans une cuisine

      Conférences
    • zetetiqueplugin-autotooltip__default plugin-autotooltip_bigZététique

      Qu’est ce que la zététique ?

      La réponse de Jean-Michel Abrassart

      * * lien youtube

      Résumé de Rémi Magnouat, avec le préambule suivant : Dans cet épisode du podcast vidéo « scepticisme scientifique », Jean-Michel Abrassart aborde le sujet de la perception de la Zététique et de la définition qui lui est donnée. J'ai été particulièrement intéressé par cet épisode car je me suis souvent questionné su…
    • zincplugin-autotooltip__default plugin-autotooltip_bigZinc

      * fr:Zinc * Zinc

      * Anodes perdues * Galvanisation * Utilisations médicales de l'oxyde de zinc qui a des propriétés cicatrisantes et anti-inflammatoires. Il est un des composants des crèmes, ou ajouté au talc

      * voir aussi : * Calamine
  • 2025scolaireplugin-autotooltip__default plugin-autotooltip_bigSylvie Colaire

    * secondaire : AR Mons 2019 * 1er cycle : bac chimie 2022 * 2ème cycle : master FA chimie 2024 * email perso : * email UMONS : * Matricule : 250219 * occupation : non * mobile : 0499 99 11 22 * réside : Mons

    Stage 1
  • 2025templateplugin-autotooltip__default plugin-autotooltip_big@FIRSTNAME@ @NAME@

    * secondaire : @SECONDAIRE@ * 1er cycle : @CYCLE1@ * 2ème cycle : @CYCLE2@ * email perso : <@EMAILPERSO@> * email UMONS : <@EMAILUMONS@> * Matricule : @MATRICULE@ * occupation : @OCCUPATION@ * mobile : @MOBILE@ *
  • aboutmeplugin-autotooltip__default plugin-autotooltip_bigContact et données personnelles

    Pour me contacter, vous pouvez utiliser ce formulaire de contact

    Vous trouverez sur la même page l'adresse de courrier, un plan d'accès utilisant une carte glissante OpenStreetMap et un mini-cv.

    Divers

    * Opinions et points de vue divers * Rôles des Universités
  • avisplugin-autotooltip__default plugin-autotooltip_bigOpinions et points de vue divers

    On trouvera ici des avis sur un peu de tout !

    Certains avis approfondis (ou qui devraient l'être) font l'objet de pages spécifiques :

    * Rôles des Universités * Changement climatique * ...

    La qualité des publications scientifiques

    La qualité diminue
  • bootstrapwrapperplugin-autotooltip__default plugin-autotooltip_bigBootstrap Wrapper

    Extension nécessitant un thème Bootstrap.

    Jumbotron

    Hello, world!

    This is a simple hero unit, a simple jumbotron-style component for calling extra attention to featured content or information.

    Panel

    Panel content

    Alert Well done!
  • didactiqueplugin-autotooltip__default plugin-autotooltip_bigActivités et Recherches en didactique de la chimie

    Publications

    * Une ligne du temps de la chimie et ses possibilités d'utilisation. Didier VILLERS, Michel DRAMAIX et René VAN ELSUWE. Bulletin de l'ABPPC (association belge des professeurs de physique et chimie) N°160, Janvier-Février-Mars 2004.
  • dokuwiki_extensionsplugin-autotooltip__default plugin-autotooltip_bigExtensions (sélection)

    Quelques démonstrations...

    Bookcreator

    Utiliser l'interface via l'icône “ajouter au livre” à droite....

    Bootstrap Wrapper

    * Bootstrap Wrapper (extension nécessitant un thème Bootstrap)

    Bureaucracy, pagemod, struct

    * bureaucracy * pagemod
  • dokuwiki_presentation_20170515plugin-autotooltip__default plugin-autotooltip_big* CMS (content management system) * Wiki : création, modification et illustration collaboratives de pages web * syntaxe simple, langage de balisage aisé, extensible * Travail en équipe (collègues, étudiants,...) * Contrôle des accès :
  • f9h4y7kplugin-autotooltip__default plugin-autotooltip_bigL’inspection de biologie, chimie, mathématique et physique dans le secondaire du degré supérieur

    Exposé de l'inspection en sciences, UMONS, 19 décembre 2011, par :

    * Nicole Lambelin (Mathématique) * Martine Schellings (biologie/chimie)
  • flossplugin-autotooltip__default plugin-autotooltip_bigLogiciels libres

    * Répertoire de logiciels * Python * LaTeX * Linux * Windows & applications portables

    Autant que possible, j'utilise et je recommande l'utilisation de logiciels libres. Je suis impliqué dans l'organisation d'un cycle de conférences à Mons, chaque troisième jeudi du mois : Les Jeudis du Libre de Belgique à Mons

    Je suis également membre actif de l'A.S.B.L.
  • iconsplugin-autotooltip__default plugin-autotooltip_bigicons

    Page des icônes utilisés ou utilisables sur le site Références

    Logos sous licences libres :

    * education : * chemistry : * physics : * floss : * numeric :
  • installation_dokuwikiplugin-autotooltip__default plugin-autotooltip_big* Installation par le CI d'un serveur virtuel Ubuntu * mise à jour, et installation de clés SSH * Installation du serveur : * LAMP : sudo apt-get install apache2 php5 mysql-server libapache2-mod-php5 php5-mysql * mot de passe superutilisateur root mysql : mdp001
  • interfacesplugin-autotooltip__default plugin-autotooltip_bigFilms, surfaces et interfaces

    English : physical chemistry, hydrodynamical and mechanical interfacial properties

    Français : Physicochimie, propriétés mécaniques et hydrodynamique interfaciale

    Publications

    * How the geometry controls the tearing of adhesive thin films on curved surfaces. O. Kruglova, F. Brau, D. Villers & P. Damman, Physical Review Letters 107, 164303 (2011).
  • jupyter_presentation_20180316plugin-autotooltip__default plugin-autotooltip_bigUn cours à rejouer, avec Jupyter

    Journée des enseignants, UMONS, 16/03/2018

    * Titre : « Un cours à rejouer, avec Jupyter » * Didier VILLERS, * Descriptif de la thématique :

    ......

    Synthétiquement : Jupyter Notebooks

    * Serveur Web + langages de programmation et librairies de codes
  • liensplugin-autotooltip__default plugin-autotooltip_bigLiens Web divers

    (en recontruction)

    Fournisseurs d'informations générales

    Bibliothèques réelles et virtuelles

    * Gallica, bibliothèque numérique (Bibliothèque Nationale de France) *

    Dictionnaires, encyclopédies

    * Wiktionnaire * Wikipédia

    Médias, éditeurs

    * Le Monde Diplomatique * ...
  • mailing_form-testplugin-autotooltip__default plugin-autotooltip_bigFormulaire d'inscription à un mailing

    Pour inscription au mailing. Indiquer commentaires + respect privacy (ref UMONS) ...

    ajouter timestamp, CAPTCHA, référence à une privacy policy, cases à cocher ?
  • mailing_resultplugin-autotooltip__default plugin-autotooltip_bigInscrits au mailing

    Pour modifier la page (ajouts), allez ici Prénom Nom email accord Désinscription Timestamp commentaire Didier Villers didier.villers@umons.ac.be
  • mapathonplugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 25 mars 2020

    FIXME : page pour l'édition 2020 en construction !!

    Liens rapides :

    * Présentation introductive générale du Mapathon 2020 * Les instructions pour faire de la carto humanitaire libre "HOT OSM" (source) * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule
  • mapathon2017plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 25 mars 2017

    Liens rapides :

    * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site * Tasking manager HOT (identifiez vous) * Choisissez un morceau de territoire à cartographier !
  • mapathon2018plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 24 mars 2018

    Liens rapides :

    * Présentation introductive générale du Mapathon du 24 mars 2018 ! * Les instructions pour faire de la carto humanitaire libre "HOT OSM" * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site * Tasking manager HOT (identifiez vous) * Choisissez un morceau de territoire à cartographier !
  • mapathon2019plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 27 mars 2019

    Liens rapides :

    * Présentation introductive générale du Mapathon 2019 * Les instructions pour faire de la carto humanitaire libre "HOT OSM" (source) * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site *
  • numericalplugin-autotooltip__default plugin-autotooltip_bigApplied numerical analysis, digital image processing

    English : these works are mainly concerned by applied numerical analysis to signal and image processing problems occuring in physical chemistry.

    Français : Mes travaux dans le domaine de l’informatique concernent principalement le développement et l’implémentation de méthodes d’analyse numérique, de traitement du signal, de l’image en vue d’applications en chimie-physique (modélisation, simulation, traitement de données expérimentales).…
  • pchplugin-autotooltip__default plugin-autotooltip_bigPhysico-chemical hydrodynamics

    English : these works mainly focused on the coupling between thermocapillary and thermogravitational convections. The use of binary alcohol systems presenting unusual dependences of the interfacial or surface tension allowed the study of both positive and negative coupling of the bulk and capillary convections. Some more occasional works have been done on limited studies, like convection implying thermodiffusion (Soret effect), Laser Doppler Velocimetry (LDV), and…
  • polymerplugin-autotooltip__default plugin-autotooltip_bigPolymer physical chemistry

    English : these works are concerned with structure, morphology and crystallization of semi-crystalline polymers as molecular complexes of poly(oxy ethylene), poly aryl ether ketones, aliphatic polyesters and block copolymers.
  • revolution_numeriqueplugin-autotooltip__default plugin-autotooltip_bigLa révolution numérique

    Présentation donnée lors de la conférence “La révolution numérique : entre mythes et réalités”, donnée le 29/02/2016, dans le cadre du cycle Révolutions (conférences organisées par l'extension de l'Université de Mons).

    Liens complémentaires

    * La Pascaline *
  • startplugin-autotooltip__default plugin-autotooltip_bigDIDACTIQUE ET FORMATIONS UMONS [DIDACTIQUE ET FORMATIONS UMONS]

    Service de Didactique des Disciplines Scientifiques

    Agrégation et masters didactiques CAPAES

    Ecole de Formation des Enseignants

    CHIMIE-PHYSIQUE (enseignements) [CHIMIE-PHYSIQUE (enseignements)] [CHIMIE-PHYSIQUE (enseignements)]

    • Enseignements

    • PhysicoChimie I

    • Thermodynamique statistique (exercices)

    • Publications intéressantes

    • Applications intéressantes

    NUMÉRIQUE (enseignements) [NUMÉRIQUE (enseignements…
  • startnewplugin-autotooltip__default plugin-autotooltip_bigDIDACTIQUE ET FORMATIONS UMONS [DIDACTIQUE ET FORMATIONS UMONS]

    Service de Didactique des Disciplines Scientifiques

    Agrégation et masters didactiques CAPAES

    Ecole de Formation des Enseignants

    CHIMIE-PHYSIQUE (enseignements) [CHIMIE-PHYSIQUE (enseignements)] [CHIMIE-PHYSIQUE (enseignements)]

    • Enseignements

    • PhysicoChimie I

    • Thermodynamique statistique (exercices)

    • Publications intéressantes

    • Applications intéressantes

    NUMÉRIQUE (enseignements) [NUMÉRIQUE (enseignements…
  • startoldplugin-autotooltip__default plugin-autotooltip_bigDivers

    * Formulaire de contact, blog : * Le Service de Didactique des Disciplines Scientifiques : (site en construction) * Activités d'enseignement * Chimie-physique * Programmation appliquée à la chimie, méthodes de calcul, et initiation à l'informatique * Didactique de la chimie et autres activités de l'AESS et du CAPAES en Faculté des Sciences * les Unités d’acquis d’apprentissage en chimie dans le secondaire *…
  • startold2plugin-autotooltip__default plugin-autotooltip_big* Formulaire de contact DIDACTIQUE [DIDACTIQUE] ET FORMATIONS UMONS
  • tableau-testplugin-autotooltip__default plugin-autotooltip_bigTableau test

    Colonne1 Colonne 2 Colonne 3 valeur tagadapouet pouet valeur tagadapouet pouet
  • teachingplugin-autotooltip__default plugin-autotooltip_bigEnseignements

    Mes enseignements actuels se répartissent dans les trois domaines : chimie-physique, informatique et didactique de la chimie.

    J’utilise notamment la plateforme d’enseignement en ligne « Moodle » de l’UMONS.

    Voir aussi la page concernant les activités de vulgarisation scientifique.
  • test-rssplugin-autotooltip__default plugin-autotooltip_bigLes dernières conférences du cycle des Jeudis du Libre :

    Mediapart :

    Le Monde
  • test-tableplugin-autotooltip__default plugin-autotooltip_bigtest d'une table

    tagada COMPÉTENCES Compétences et savoir-faire scientifiques Appréhender une réalité complexe.Faire émerger l'énigme à résoudre : 01. Formuler des questions à partir d'une observation, d'une information, d'un événement,
  • testplugin-autotooltip__default plugin-autotooltip_bigtest

    test
  • test_doodle4plugin-autotooltip__default plugin-autotooltip_bigTest de l'extension doodle4

    Test de l'extension doodle4
  • trevesplugin-autotooltip__default plugin-autotooltip_bigTrèves

    13 au 15 décembre

    * Berghotel Kockelsberg3,5 étoiles - Kockelsberg 1, Trèves, RP, 54293, Allemagne * * * * * * * parking * * *
  • vote-451217plugin-autotooltip__default plugin-autotooltip_bigVote 451217

    Vote 451217
  • teaching/progappchim/elements_molecules.txt
  • Dernière modification: 2020/03/09 14:41
  • de villersd