teaching:progappchim:bioinformatic

Bioinformatique

Un des objectifs majeurs de la bioinformatique réside dans l'étude automatique de séquences, principalement de l'ADN et de protéines,…

Ces séquences sont accessibles librement et publiquement, notamment par ces deux sources :

Snippet de Wikipédia: UniProt

UniProt est une base de données de séquences de protéines. Son nom dérive de la contraction de Universal Protein Resource (base de données universelle de protéines). C'est une base de données ouverte, stable et accessible en ligne, elle est issue de la consolidation de l'ensemble des données produites par la communauté scientifique. UniProt est une base annotée, hiérarchisée où chaque séquence est accompagnée d'un ensemble riche de métadonnées et de liens vers de nombreuses autres bases de données : bibliographiques, phylogénétiques, nucléotidiques... Outre la séquence en acides aminés des protéines, UniProt fournit des informations sur leur fonction et leur structure ainsi que des liens vers d'autres bases de données.

UniProt combine les données des bases Swiss-Prot, TrEMBL et Protein Information Resource (PIR) et est mise à jour régulièrement. Ses données reposent entre autres sur le serveur ExPASy de l'Institut suisse de bioinformatique et celui de l'EBI. Ces serveurs proposent en particulier la recherche de séquences homologues dans la base au moyen d'outils d'alignement de séquences comme FASTA ou BLAST.

Voir aussi le site https://www.uniprot.org/

Snippet de Wikipédia: GenBank

La GenBank est une base de données de la séquences d'ADN, comprenant toutes les séquences de nucléotides publiquement disponibles et leur traduction en protéines. Cette base de données américaine « Nucleotide », en libre accès, a été créée au Centre national pour l'information biotechnologique (NCBI) dans le cadre de la collaboration internationale sur le séquençage des nucléotides (INSDC selon le sigle anglais). La GenBank et ses collaborateurs reçoivent des séquences produites dans des laboratoires du monde entier à partir de plus de 100 000 organismes différents. La GenBank continue de grossir avec une vitesse exponentielle, doublant de taille tous les dix mois. La version 155, datée d'août 2006, contenait plus de 65 milliards de bases de nucléotides dans plus de 61 millions de séquences. La GenBank se construit soit par des dépôts directs en provenance de laboratoires, soit des dépôts en masse des centres de séquençage à grande échelle.

Les dépôts directs à la GenBank se font par l'intermédiaire de BankIt, qui est un formulaire Internet, ou par le programme de dépôt autonome, Sequin. À la réception du dépôt d'une séquence, l'équipe de la GenBank attribue un numéro d'ordre à la séquence et réalise les contrôles d'assurance qualité. Les dépôts sont ensuite inscrits dans la base de données publique, dont on peut consulter les entrées par Entrez ou les télécharger par FTP. Les dépôts en masse de données de marqueurs de séquences exprimées, Sequence Tagged Site (STS), Genome Survey Sequence (GSS) et High-Throughput Genome Sequence (HTGS) sont généralement transmis par les centres de séquençage à grande échelle. Les dépôts de groupe directs à la GenBank traitent également des séquences complètes de génomes microbiens.

Voir aussi le site https://www.ncbi.nlm.nih.gov/genbank/

Biopython est une librairie de programmes en langage Python dédiée à l'étude de séquences (ADN, ARN, protéines). Pour utiliser cette librairie, elle doit-être installée au préalable, par exemple :

  • Avec la distribution Anaconda, via l'interface Anaconda-Navigator, au départ du canal “conda-forge' ou par la commande suivante : conda install -c conda-forge biopython
  • via le site Pypi (pypi.org) et la commande suivante : pip install biopython
Counting_DNA_Nucleotides-01.py
#!/usr/bin/env python
# -*- coding: utf-8 -*-
"""
On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T')
Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases
"""
adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
 
# utilisation d'une liste et de la méthode .count()
bases = ["A","C","G","T"]
for base in bases:
    print(adn.count(base),)
print()
 
# Variante :
for c in 'ACGT':
    print(adn.count(c),)
print()
 
# variante un peu moins lisible
out = []
for c in 'ACGT':
    out.append(str(adn.count(c)))
print(' '.join(out))
 
# utilisation de la technique "list comprehension"
count = [adn.count(c) for c in 'ACGT']
for val in count:
    print(val,)
print()
 
# autre "list comprehension", avec impression formatée → version "one line"
print("%d %d %d %d" % tuple([adn.count(X) for X in "ACGT"]))
 
# count "à la main", sans utilisation de fonctions/librairie
ACGT = "ACGT"
count = [0,0,0,0]
for c in adn:
    for i in range(len(ACGT)):
        if c == ACGT[i]:
            count[i] +=1
for val in count:
    print(val,)
print()
 
# count "à la main", avec .index()
ACGT = "ACGT"
count = [0,0,0,0]
for c in adn:
    count[ACGT.index(c)] += 1
for val in count:
    print(val,)
print()
 
# utilisation de la librairie collections
from collections import defaultdict
ncount = defaultdict(int)
for c in adn:
    ncount[c] += 1
print(ncount['A'], ncount['C'], ncount['G'], ncount['T'])
 
# collections.Counter
from collections import Counter
for k,v in sorted(Counter(adn).items()):
    print(v,)
print()
 
# avec un dictionnaire
freq = {'A': 0, 'C': 0, 'G': 0, 'T': 0}
for c in adn:
    freq[c] += 1
print(freq['A'], freq['C'], freq['G'], freq['T'])
 
# avec un dictionnaire et count(), impression différente
dico={}
for base in bases:
    dico[base] = adn.count(base)
for key,val in dico.items():
    print("{} = {}".format(key, val))

+ lecture de fichier

Finding_a_Protein_Motif-01.py
#!/usr/bin/env python
# -*- coding: utf-8 -*-
"""
La description complète et les caractéristiques d'une protéine particulière peuvent être obtenues via l'ID "uniprot_id" de la "UniProt database", en insérant la référence dans ce lien : 
http://www.uniprot.org/uniprot/uniprot_id
 
On peut aussi obtenir la séquence peptidique au format FASTA via le lien :
http://www.uniprot.org/uniprot/uniprot_id.fasta
"""
 
from Bio import SeqIO
from Bio import ExPASy
from Bio import SeqIO
 
dic = {"UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L",
    "UCU":"S", "UCC":"S", "UCA":"S", "UCG":"S",
    "UAU":"Y", "UAC":"Y", "UAA":"STOP", "UAG":"STOP",
    "UGU":"C", "UGC":"C", "UGA":"STOP", "UGG":"W",
    "CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L",
    "CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P",
    "CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q",
    "CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R",
    "AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M",
    "ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T",
    "AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K",
    "AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R",
    "GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V",
    "GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A",
    "GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E",
    "GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G",}
 
aminoacids = ''.join(sorted(list(set([v for k,v in dic.items() if v != "STOP"]))))
print(aminoacids)
 
# UniProt Protein Database access IDs
proteins = ['A2Z669', 'B5ZC00', 'P07204_TRBM_HUMAN', 'P20840_SAG1_YEAST'] 
 
handle = ExPASy.get_sprot_raw(proteins[0])
seq_record = SeqIO.read(handle, "swiss")
handle.close()
print()
print(seq_record)
Ce site web utilise des cookies. En utilisant le site Web, vous acceptez le stockage de cookies sur votre ordinateur. Vous reconnaissez également que vous avez lu et compris notre politique de confidentialité. Si vous n'êtes pas d'accord, quittez le site.En savoir plus
  • teaching/progappchim/bioinformatic.txt
  • Dernière modification: 2021/03/03 10:27
  • de villersd