teaching:progappchim:dictionary_adn_protein

Traduction de l'ADN en séquence d'acides aminés

<sxh python; title : dictionary_adn_protein.py> #!/usr/bin/env python # -*- coding: iso-8859-1 -*-

# python code to translante DNA sequences into proteins # traduction de l'ADN en séquence d'acides aminés (protéine)

def translate_dna(sequence): # to translate a DNA sequence in equivalent protein

  # see http://fr.wikipedia.org/wiki/Code_g%C3%A9n%C3%A9tique
  # http://en.wikipedia.org/wiki/Genetic_code
  gencode = {                   # définition d'un dictionnaire dont chaque clé (un codon de 3 nucléotides) donne l'acide aminé correpondant
  'ATA':'I', 'ATC':'I', 'ATT':'I', 'ATG':'M',  
  'ACA':'T', 'ACC':'T', 'ACG':'T', 'ACT':'T',  
  'AAC':'N', 'AAT':'N', 'AAA':'K', 'AAG':'K',  
  'AGC':'S', 'AGT':'S', 'AGA':'R', 'AGG':'R',  
  'CTA':'L', 'CTC':'L', 'CTG':'L', 'CTT':'L',  
  'CCA':'P', 'CCC':'P', 'CCG':'P', 'CCT':'P',  
  'CAC':'H', 'CAT':'H', 'CAA':'Q', 'CAG':'Q',  
  'CGA':'R', 'CGC':'R', 'CGG':'R', 'CGT':'R',  
  'GTA':'V', 'GTC':'V', 'GTG':'V', 'GTT':'V',  
  'GCA':'A', 'GCC':'A', 'GCG':'A', 'GCT':'A',  
  'GAC':'D', 'GAT':'D', 'GAA':'E', 'GAG':'E',  
  'GGA':'G', 'GGC':'G', 'GGG':'G', 'GGT':'G',  
  'TCA':'S', 'TCC':'S', 'TCG':'S', 'TCT':'S',  
  'TTC':'F', 'TTT':'F', 'TTA':'L', 'TTG':'L',  
  'TAC':'Y', 'TAT':'Y', 'TAA':'_', 'TAG':'_',  
  'TGC':'C', 'TGT':'C', 'TGA':'_', 'TGG':'W',
  }
  print sequence  
  proteinseq = ''  
  for n in range(0,len(sequence),3):  
      if gencode.has_key(sequence[n:n+3]) == True:  # check that key exists in dictionary
          proteinseq += gencode[sequence[n:n+3]]  
  return proteinseq

# DNA sequences : GenBank : http://www.ncbi.nlm.nih.gov/

se='GTGACTTTGTTCAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGTAATCACTTGTTCTTTAAATAAGGACTAGTATGAATGGCATCACGAGGGCTTTACTGTCTCCTTTTTCTAATCAGTGAA' #se='GTGACTTTG' print len(se) print translate_dna(se)

# extensions : lire la séquence à partir d'un fichier # générer des mutations aléatoires de l'ADN et examiner les modifications éventuelles de la protéine # faire correspondre des noms complets ou abbréviations sur 3 lettres des acides aminés # générer l'ARN correspondant </sxh>

Ce site web utilise des cookies. En utilisant le site Web, vous acceptez le stockage de cookies sur votre ordinateur. Vous reconnaissez également que vous avez lu et compris notre politique de confidentialité. Si vous n'êtes pas d'accord, quittez le site.En savoir plus
  • teaching/progappchim/dictionary_adn_protein.txt
  • Dernière modification: 2012/11/30 13:28
  • de villersd