teaching:ressourceschimie

Ressources en enseignement de la chimie

  • Unités d’acquis d’apprentissageplugin-autotooltip__default plugin-autotooltip_bigLes unités d’acquis d’apprentissage

    L'objectif de cette page est de présenter sous forme de texte électronique cherchable les référentiels “UAA” de chimie dans l'enseignement secondaire (général et technique de transition ou qualification).
  • Vue globale des programmes :
    • Sciences générales - Tableau synoptique de chimie - FWBplugin-autotooltip__default plugin-autotooltip_bigSciences générales - Tableau synoptique de chimie - FWB

      Les indications proposées des nombres de périodes le sont pour les sous-titres et sous-sous-titres énoncés jusqu'à l'indication suivante. Pour chaque unité d'acquis d'apprentissage, il est souvent proposé de consacrer une période à des évaluations formatives et une période à l'évaluation sommative. Mais par exemple pour l'uaa 6 ce sera deux fois une demi période, tandis que pour l'uaa 10, les durées d'évaluation sont de deux périodes.…
    • Sciences de base - Tableau synoptique de chimie - FWBplugin-autotooltip__default plugin-autotooltip_bigSciences de base - Tableau synoptique de chimie - FWB

      Les indications proposées des nombres de périodes le sont pour les sous-titres et sous-sous-titres énoncés jusqu'à l'indication suivante. Pour chaque unité d'acquis d'apprentissage, il est souvent proposé de consacrer une période à des évaluations formatives et une période à l'évaluation sommative, et parois un peu moins ou un peu plus.
    • Tableaux synoptiques du SEGECplugin-autotooltip__default plugin-autotooltip_bigTableaux synoptiques du SEGEC (2017)

      Pour les sciences, et en particulier la chimie, le SEGEC (enseignement catholique) propose des tableaux synoptiques de ses programmes. Lien direct :

      Sciences de base

      Tableau synoptique de chimie

      * 1er degré
      (enseignement catholique)
  • Glossaire de termes usuels en chimieplugin-autotooltip__default plugin-autotooltip_bigGlossaire de termes usuels de chimie

    Ce glossaire reprend principalement les termes chimiques utilisés dans le cours de chimie de l'enseignement secondaire belge (cf. les unités d'acquis d'apprentissage de chimie en sciences générales). Le niveau des définitions est adapté au niveau d'étude. L'ensemble est placé sous licence libre $\chi_{A}$
  • Ligne du temps de la chimieplugin-autotooltip__default plugin-autotooltip_bigLigne du Temps de la Chimie

    Préambule

    Toute science progresse par la réalisation et l'interprétation d'expériences, par l'introduction de nouveaux concepts, ... Des améliorations et corrections se succèdent alors, dévoilant parfois des erreurs ou des imprécisions du passé. Dans de nombreuses situations, la recherche scientifique induit des interrogations sur l'articulation des travaux actuels par rapport à la masse des connaissances précédentes. Dès lors, on se rend compte qu'une connaissanc…
  • Sélection d'articles en didactique de la chimieplugin-autotooltip__default plugin-autotooltip_bigSélection d'articles en didactique de la chimie

    Liens rapides :

    * : numéro courant de Journal of Chemical Education où vous avez la possibilité de consulter les résumés. Si vous souhaitez recevoir la table des matières à chaque nouveau numéro, il vous suffit de prendre l'option
    • Publications intéressantesplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes en didactique de la chimie, mais pas seulement

      La plupart des résumés de publications sont issus d'analyses d'articles effectuées par des étudiants dans le cadre des études d'AESS en chimie ou de bacheliers/masters en chimie (les initiales et années sont alors indiquées), pour des publications souvent issues de cette
      (résumés)
  • Des informations ou désinformations ?plugin-autotooltip__default plugin-autotooltip_bigDes informations ou désinformations ?

    Cette page regroupe quelques exemples d'informations et désinformations, notamment tirés de différents media : presse, réseaux sociaux, blogs, forums,... des désinformations, et parfois aussi une information qui se veut plus conforme aux faits.
    → sources pour contrer les fakenews, théories du complots,…
  • La cuisine moléculaireplugin-autotooltip__default plugin-autotooltip_bigLa cuisine moléculaire

    L'alimentation serait à l'origine de nos capacités neuronales plus importantes : cf. Suzana Herculano-Houzel’s TED talk

    Situations d'apprentissage

    * la mayonnaise ratée * l'œuf est très souvent trop cuit : * le jaune devient verdâtre * le jaune est trop sec
  • Sélection de questions et réponses en chimie sur chemistry.stackexchangeplugin-autotooltip__default plugin-autotooltip_bigQuestions et réponses en chimie sur chemistry.stackexchange

    Chemistry Stack Exchange est un site de questions et réponses pour les scientifiques, les enseignants, les étudiants,... Il est gratuit, est son contenu est sous licence libre (copyleft) Creative Commons BY-SA. Aucune inscription n'est requise pour la consultation. Vous devez vous identifier pour y contribuer. Le fonctionnement est réglé par un système de
  • Images sous licence libre en chimieplugin-autotooltip__default plugin-autotooltip_bigImages libres en chimie

    * N'oubliez pas de respecter les licences (sauf domaine public ou licence CC-zero), cf. les explications à la page Ressources éducatives libres. Voir en particulier les sources mentionnées ici : Images libres * Plutôt que de copier l'image, surfez vers le lien afin de sélectionner la résolution qui vous convient
  • Ressources éducatives sous licence libre en chimieplugin-autotooltip__default plugin-autotooltip_bigRessources éducatives libres

    Cette page répertorie des ressources libres, au sens du domaine public ou des licences de type Creative Commons CC-BY-SA, CC-BY, ou CC-Zero, compatibles par exemple avec Wikipedia (qui est sous licence CC-BY-SA).

    Précision sur la notion de libre, opensource, ouvert(ure)
  • Ressources pour la création de séquences vidéos et l'enseignement à distanceplugin-autotooltip__default plugin-autotooltip_bigRessources pour la création de séquences vidéos et l'enseignement à distance

    Conseils généraux pour la conception

    * conseils, longueurs, styles,... * Planifier, réaliser et diffuser des vidéos éducatives : lignes directrices et astuces pour les enseignants, Caroline Cormier, Edward Awad, Yann Brouillette et Véronique Turcotte (canada). Article reprenant des exemples de capsule en chimie
  • Pages en construction :
    • Vidéos pour le cours de chimie sciences généralesplugin-autotooltip__default plugin-autotooltip_bigVidéos pour le cours de chimie sciences générales





      Cette page reprend des références de vidéos utilisables dans un cours de chimie “Sciences générales”, suivant le programme du réseau officiel de la FWB. Ces vidéos sont évidemment tout aussi exploitables pour un autre cours de chimie (autre programme, sciences …
  • Psychologie de l'éducationplugin-autotooltip__default plugin-autotooltip_bigPsychologie de l'éducation

    Thèmatiques reliées : neurosciences, cognition/métacognition, motivation,...

    Principes fondamentaux

    * Comment pensent et apprennent les élèves ? * PRINCIPE 1 - Les convictions et perceptions de l’élève sur son intelligence et ses aptitudes influencent son mode de fonctionnement cognitif et son apprentissage.
    principes fondamentaux, publications majeures,…

startplugin-autotooltip__default plugin-autotooltip_bigDIDACTIQUE ET FORMATIONS UMONS [DIDACTIQUE ET FORMATIONS UMONS]

Service de Didactique des Disciplines Scientifiques

Agrégation et masters didactiques CAPAES

Ecole de Formation des Enseignants

CHIMIE-PHYSIQUE (enseignements) [CHIMIE-PHYSIQUE (enseignements)] [CHIMIE-PHYSIQUE (enseignements)]

• Enseignements

• PhysicoChimie I

• Thermodynamique statistique (exercices)

• Publications intéressantes

• Applications intéressantes

NUMÉRIQUE (enseignements) [NUMÉRIQUE (enseignements…

  • Extensions (sélection)plugin-autotooltip__default plugin-autotooltip_bigExtensions (sélection)

    Quelques démonstrations...

    Bookcreator

    Utiliser l'interface via l'icône “ajouter au livre” à droite....

    Bootstrap Wrapper

    * Bootstrap Wrapper (extension nécessitant un thème Bootstrap)

    Bureaucracy, pagemod, struct

    * bureaucracy * pagemod
  • Inscrits au mailingplugin-autotooltip__default plugin-autotooltip_bigInscrits au mailing

    Pour modifier la page (ajouts), allez ici Prénom Nom email accord Désinscription Timestamp commentaire Didier Villers didier.villers@umons.ac.be
  • Bootstrap Wrapperplugin-autotooltip__default plugin-autotooltip_bigBootstrap Wrapper

    Extension nécessitant un thème Bootstrap.

    Jumbotron

    Hello, world!

    This is a simple hero unit, a simple jumbotron-style component for calling extra attention to featured content or information.

    Panel

    Panel content

    Alert Well done!
  • rv
    • 2020-03
      • 2020-03-16plugin-autotooltip__default plugin-autotooltip_big2020-03-16

        * début du Lockdown
  • Collaboration avec l'ISP Bukavu
    • @FIRSTNAME@ @NAME@plugin-autotooltip__default plugin-autotooltip_big@FIRSTNAME@ @NAME@

      * secondaire : @SECONDAIRE@ * 1er cycle : @CYCLE1@ * 2ème cycle : @CYCLE2@ * email perso : <@EMAILPERSO@> * email UMONS : <@EMAILUMONS@> * Matricule : @MATRICULE@ * occupation : @OCCUPATION@ * mobile : @MOBILE@ *
    • Contact et données personnellesplugin-autotooltip__default plugin-autotooltip_bigContact et données personnelles

      Pour me contacter, vous pouvez utiliser ce formulaire de contact

      Vous trouverez sur la même page l'adresse de courrier, un plan d'accès utilisant une carte glissante OpenStreetMap et un mini-cv.

      Divers

      * Opinions et points de vue divers * Rôles des Universités
    • Activités et Recherches en didactique de la chimieplugin-autotooltip__default plugin-autotooltip_bigActivités et Recherches en didactique de la chimie

      Publications

      * Une ligne du temps de la chimie et ses possibilités d'utilisation. Didier VILLERS, Michel DRAMAIX et René VAN ELSUWE. Bulletin de l'ABPPC (association belge des professeurs de physique et chimie) N°160, Janvier-Février-Mars 2004.
    • Un cours à rejouer, avec Jupyterplugin-autotooltip__default plugin-autotooltip_bigUn cours à rejouer, avec Jupyter

      Journée des enseignants, UMONS, 16/03/2018

      * Titre : « Un cours à rejouer, avec Jupyter » * Didier VILLERS, * Descriptif de la thématique :

      ......

      Synthétiquement : Jupyter Notebooks

      * Serveur Web + langages de programmation et librairies de codes
    • Mapathon à l'UMONS le 25 mars 2017plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 25 mars 2017

      Liens rapides :

      * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site * Tasking manager HOT (identifiez vous) * Choisissez un morceau de territoire à cartographier !
    • Enseignementsplugin-autotooltip__default
      • Les perceptions des enseignants sur l'enseignement des acides et bases dans l'enseignement secondaire suédoisplugin-autotooltip__default plugin-autotooltip_bigLes perceptions des enseignants sur l'enseignement des acides et bases dans l'enseignement secondaire suédois

        Teacher’s perceptions of the teaching of acides and bases in Swedish upper secondary schools, Michal Drechsler and Jan Van Driel, Chemistry Education Research and Practice, 2009, 10, 86-96 DOI: 10.1039/B908246H Résumé de L.B., 2010-2011. (accès gratuit possible via le site de la RSC)
      • Argentplugin-autotooltip__default plugin-autotooltip_bigArgent

        Vidéos :

        * *
      • Tampon en contexte : lingettes pour bébé comme solution tamponplugin-autotooltip__default plugin-autotooltip_bigTampon en contexte : lingettes pour bébé comme solution tampon

        Article : Buffers in Context: Baby Wipes As a Buffer System Jon-Marc G. Rodriguez, Sarah Hensiek, Jeanne R. Meyer, Cynthia J. Harwood, and Marcy H. Towns, J. Chem. Educ., 2018, 95 (10), pp 1816–1820 DOI: 10.1021/acs.jchemed.8b00378 résumé de M.M.M. 2018-2019
      • Oxygèneplugin-autotooltip__default plugin-autotooltip_bigOxygène

        FIXME

        Cycle global

        * (océan ou Amazonie “poumon” de la terre ?) : Le dioxygène, dont la concentration est d’environ 200 000 ppm, a diminué de 80 ppm en 20 ans ! Sur la même période, le CO2 a augmenté d’un peu moins de 40 ppm.
      • Doigts les plus rapides: un jeu de construction de molécules pour l'enseignement de la chimie organiqueplugin-autotooltip__default plugin-autotooltip_bigDoigts les plus rapides: un jeu de construction de molécules pour l'enseignement de la chimie organique

        Fastest Fingers: A Molecule-Building Game for Teaching Organic Chemistry Michael L. Eastwood, J. Chem. Educ., 2013, 90 (8), pp 1038–1041 DOI: 10.1021/ed3004462 Résumé de T.F. 2013-2014

        Enseigner la chimie organique à des élèves débutants n’est pas une chose facile. En tant que des futurs enseignants, nous serons confronté à ce genre de situation et il nous reviendra de droit d’apporter que…
      • Sélection d'articles en didactique de la chimieplugin-autotooltip__default plugin-autotooltip_bigSélection d'articles en didactique de la chimie

        Liens rapides :

        * : numéro courant de Journal of Chemical Education où vous avez la possibilité de consulter les résumés. Si vous souhaitez recevoir la table des matières à chaque nouveau numéro, il vous suffit de prendre l'option
      • Des informations ou désinformations ?plugin-autotooltip__default plugin-autotooltip_bigDes informations ou désinformations ?

        Cette page regroupe quelques exemples d'informations et désinformations, notamment tirés de différents media : presse, réseaux sociaux, blogs, forums,... des désinformations, et parfois aussi une information qui se veut plus conforme aux faits.
      • Création et expérimentation d'un système robuste et peu coûteux pour démontrer visuellement la pression de vapeur des liquides en fonction de la températureplugin-autotooltip__default plugin-autotooltip_bigCréation et expérimentation d'un système robuste et peu coûteux pour démontrer visuellement la pression de vapeur des liquides en fonction de la température

        Article : Creating and Experimenting with a Low-Cost, Rugged System to Visually Demonstrate the Vapor Pressure of Liquids as a Function of Temperature Rodrigo Papai, Mayara Araujo Romano, Aline Rodrigues Arroyo, Bárbara Rodrigues da Silva, Bruno Tresoldi, Gabriela Cabo Winter, Julia Messias Costa, Maria Aparecida Freitas Santos, Matheus Dam…
      • Chimie – Sciences générales – UAA 9 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 9 – Troisième degré

        La macromolécule en chimie organique

        Compétences à développer

        * Evaluer l’importance des macromolécules dans notre environnement.

        Processus

        Appliquer

        Transférer

        * Mener une recherche permettant de classer les polymères selon leurs propriétés physiques (par exemple : thermoplastique, thermodurcissable, élastomère,
      • Chimie – Sciences générales – UAA 8 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 8 – Troisième degré

        La molécule en chimie organique

        Compétences à développer

        * Evaluer l’importance des substances organiques dans l’environnement quotidien du consommateur responsable. * Décrire des spécificités de la chimie du carbone
      • Une nouvelle approche de la chimie et un modèle pour réformer le curriculumplugin-autotooltip__default plugin-autotooltip_bigUne nouvelle approche de la chimie et un modèle pour réformer le curriculum

        Chemistry, Life, the Universe, and Everything: A New Approach to General Chemistry, and a Model for Curriculum Reform Melanie Cooper and Michael Klymkowsky, J. Chem. Educ., 2013, 90 (9), pp 1116–1122 DOI: 10.1021/ed300456y

        Résumé

        Pendant de nombreuses années, la chimie a connu de nombreuses réformes mais qui étaient surtout basées sur ce qui doit être enseigné, comme par exemple la nomenclature chimique, et pas sur ce…
      • Fausse conceptions à propos de la nature particulaire de la matière. Utiliser des animations pour combler l'écart entre les genresplugin-autotooltip__default plugin-autotooltip_bigFausse conceptions à propos de la nature particulaire de la matière. Utiliser des animations pour combler l'écart entre les genres

        Misconceptions about the Particulate Nature of Matter. Using Animations To Close the Gender Gap, Ellen J. Yezierski, James P. Birk, J. Chem. Educ., 2006, 83 (6), p 954 DOI: 10.1021/ed083p954. Résumé X.V., 2012-2013.
      • Palladiumplugin-autotooltip__default plugin-autotooltip_bigPalladium

        FIXME : à compléter

        Media

        * Catalyst made from plant roots promotes Suzuki reaction : Researchers in France have produced an active palladium catalyst from the roots of plants grown in contaminated water.
      • Efficacité des leçons basées sur la recherche utilisant les modèles au niveau particulaire pour développer la compréhension conceptuelle de la Stœchiométrie par les élèves du secondaireplugin-autotooltip__default plugin-autotooltip_bigEfficacité des leçons basées sur la recherche utilisant les modèles au niveau particulaire pour développer la compréhension conceptuelle de la Stœchiométrie par les élèves du secondaire

        Article Effectiveness of Inquiry-Based Lessons Using Particulate Level Models To Develop High School Students’ Understanding of Conceptual Stoichiometry, Stephanie Kimberlin and Ellen Yezierski, J. Chem. Educ., 2016, 93 (6), pp 1002–1009 DOI: 10.1021/acs.jchemed.5b01010 résumé de A.H. 2016-2017
      • La chimie de la photographie: un laboratoire formidableplugin-autotooltip__default plugin-autotooltip_bigLa chimie de la photographie: un laboratoire formidable

        The Chemistry of Photography: Still a Terrific Laboratory Course for Nonscience Majors Simeen Sattar, J. Chem. Educ., 2017, 94 (2), pp 183–189 DOI: 10.1021/acs.jchemed.6b00400 Résumé de T.C., 2016-2017

        Un constat : l’avènement de la photographie numérique conduit à l’évincement de la photographie conventionnelle non seulement du marché économique, de la vie courante des citoyens mais aussi des départements de photographie des collèges et …
      • Détermination sur le terrain ou en laboratoire des ions calcium de l'eau de merplugin-autotooltip__default plugin-autotooltip_bigDétermination sur le terrain ou en laboratoire des ions calcium de l'eau de mer

        Field and In-Lab Determination of Ca2+ in Seawater Robin Stoodley, Jose R. Rodriguez Nuñez, and Tessa Bartz, J. Chem. Educ., 2014, 91 (11), pp 1954–1957 DOI: 10.1021/ed4005722 résumé de S.L. 2014-2015

        Cet article nous présente un travail effectué sur le terrain par des étudiants et son intérêt.
      • Production rapide d'une membrane d'acétate de cellulose poreuse pour la filtration de l'eau à l'aide de produits chimiques facilement disponiblesplugin-autotooltip__default plugin-autotooltip_bigProduction rapide d'une membrane d'acétate de cellulose poreuse pour la filtration de l'eau à l'aide de produits chimiques facilement disponibles

        Article : Rapid Production of a Porous Cellulose Acetate Membrane for Water Filtration using Readily Available Chemicals, Adrian Kaiser, Wendelin J. Stark , and Robert N. Grass, J. Chem. Educ., 2017, 94 (4), pp 483–487 DOI: 10.1021/acs.jchemed.6b00776 résumé de E.C. 2017-2018
      • Mettez un peu de cinéma Wow! dans votre enseignement de chimieplugin-autotooltip__default plugin-autotooltip_bigMettez un peu de cinéma Wow! dans votre enseignement de chimie

        Put Some Movie Wow! in Your Chemistry Teaching, Christopher A. Frey, Marjorie L. Mikasen, Mark A. Griep, J. Chem. Educ., 2012, 89 (9), pp 1138–1143 DOI: 10.1021/ed300092t Résumé de A-P.C., 2012-2013.

        Tout comme Jurassic Park a été utilisé comme base de discussions sur la structure des protéines, de l'ADN, le clonage, etc
      • Chimie – Sciences de base – UAA 3 – Deuxième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 3 – Deuxième degré

        La réaction chimique : approche quantitative

        Compétences à développer

        * Résoudre des problèmes de stœchiométrie dans le cas de réactions complètes avec les réactifs en quantités stœchiométriques. 
      • Lithiumplugin-autotooltip__default plugin-autotooltip_bigLithium

        À compléter

        * piles, batteries + incendie, explosion,...
      • Chimie – Sciences générales – UAA 7 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 7 – Troisième degré

        Les équilibres chimiques

        Compétences à développer

        * Prévoir le sens d’évolution d’une réaction réversible * Résoudre des problèmes d’équilibre chimique.

        Processus
      • L'alchimie ancienne dans la salle de classe: une pyrotechnie déflagrante à base de mielplugin-autotooltip__default plugin-autotooltip_bigL'alchimie ancienne dans la salle de classe: une pyrotechnie déflagrante à base de miel

        Article : Ancient Alchemy in the Classroom: A Honey-Based, Deflagrating Pyrotechnic A. V. Wolfenden, N. L. kilah, J. Chem. Educ., 2018, 95 (8), pp 1350–1353 DOI:10.1021/acs.jchemed.7b00978 résumé de A.R. 2017-2018

        Introduction
      • Uraniumplugin-autotooltip__default plugin-autotooltip_bigUranium

        FIXME : composés “courants” avec de l'uranium (verrerie),...

        * fr:Uranium * fr:Catégorie:Composé_de_l'uranium

        Références :

        * A Marine‐Inspired Hybrid Sponge for Highly Efficient Uranium Extraction from Seawater Advanced Functional Materials, may 2019 DOI: 10.1002/adfm.201901009 * Alerte : de l’uranium radioactif dans nos assiettes ! avec quelques ordres de grandeur intéressants * En Belgique (cartographie) :
      • Les unités d’acquis d’apprentissageplugin-autotooltip__default plugin-autotooltip_bigLes unités d’acquis d’apprentissage

        L'objectif de cette page est de présenter sous forme de texte électronique cherchable les référentiels “UAA” de chimie dans l'enseignement secondaire (général et technique de transition ou qualification).
      • Ferplugin-autotooltip__default plugin-autotooltip_bigFer

        FIXME

        * Le soudage exothermique, également appelé soudage aluminothermique, est un procédé de soudage qui utilise du métal en fusion pour relier de manière permanente les conducteurs. La poussière d'aluminium réduit l'oxyde d'un autre métal, le plus souvent l'oxyde de fer : Fe₂O₃ + 2Al → 2Fe + Al₂O₃
      • Comment les batteries stockent et libèrent de l'énergie: explications de l'électrochimie de baseplugin-autotooltip__default plugin-autotooltip_bigComment les batteries stockent et libèrent de l'énergie: explications de l'électrochimie de base

        How Batteries Store and Release Energy: Explaining Basic Electrochemistry Klaus Schmidt-Rohr, J. Chem. Educ., 2018, 95 (10), pp 1801–1810 DOI: 10.1021/acs.jchemed.8b00479 résumé de E.F. 2018-2019

        Les batteries sont considérées comme des dispositifs qui stockent l’énergie chimique et la convertissent en énergie électrique. Malheureusement, la description standard de l'électrochimie n'explique pas p…
      • Connaître le cerveau pour mieux enseignerplugin-autotooltip__default plugin-autotooltip_bigConnaître le cerveau pour mieux enseigner

        Adapté de la présentation par Steve Masson (22 septembre 2016, UMONS)

        FIXME : achever

        Principe 1 : Éviter les neuromythes

        * Neuromythes : * Styles d’apprentissage : Les personnes apprennent mieux quand ils reçoivent l’information dans leur style d’apprentissage préféré (auditif, visuel, kinesthésique, etc.)
      • exos
        • Marche aléatoire bidimensionnelle de cellules dans des canaux microfluidiquesplugin-autotooltip__default plugin-autotooltip_bigMarche aléatoire bidimensionnelle de cellules dans des canaux microfluidiques

          Énoncé :

          En utilisant des tampons et des techniques de lithographie, des scientifiques ont réussi à produire des obstacles carrés sur un plan, formant donc un réseau de canaux microfluidiques dans lequel des cellules peuvent circuler suivant les directions baptisées nord-sud et est-ouest.
        • Spectres de rotation-vibration de molécules biatomiquesplugin-autotooltip__default plugin-autotooltip_bigSpectres de rotation-vibration de molécules biatomiques

          Rappels sur les comportements isolés de vibration et rotation

          Vibration :

          * niveaux d'énergie régulièrement espacés de dégénérescence g=1 * température caractéristique grande (par rapport à la température ambiante), par exemple 2000 - 3000 K$E_{rot} = J(J+1) k_B \theta_{rot} \ \ \ \ \ J=0,1,2,\ldots \,$$g = 2J + 1$
        • Mises du bulletin multi du Lottoplugin-autotooltip__default plugin-autotooltip_bigMises du bulletin multi du Lotto

          Le bulletin Multi (bleu) donne la possibilité de jouer plus de 6 numéros (on peut jouer de 7 à 15 numéros) dans une grille qui compte 45 numéros allant de 1 à 45.

          Le prix d’une combinaison de jeu de 6 numéros est à 1,25 €
        • Simulations numériques de marches aléatoires : programmes en Pythonplugin-autotooltip__default plugin-autotooltip_bigSimulations numériques de marches aléatoires : programmes en Python

          Génération de nombres aléatoires

          #!/usr/bin/python # -*- coding: utf-8 -*- """ cf. documentation cf http://docs.python.org/library/random.html random number generation - génération de nombres aléatoires functions of interest : choice, randint, seed """

          from random import *

          facepiece = ['pile','face'] valeurpiece = [0.01,0.02,0.05,0.1,0.2,0.5,1.,2.]

          for i in range(1): # choice : random choice of an element from a lis…
        • Lancer d'un déplugin-autotooltip__default plugin-autotooltip_bigLancer d'un dé

          Roman lead dice. A cube measuring 12x12x12mm, with one to six impressed dots on each face. Cf. Dice.

          Creative Commons Attribution-Share Alike 2.0 Generic license. Attribution: The Portable Antiquities Scheme/ The Trustees of the British Museum
        • Thermodynamique statistique I et II (exercices)plugin-autotooltip__default plugin-autotooltip_bigThermodynamique statistique I et II (exercices)

          Bachelier en sciences chimiques, troisième année, 15 H (partie I) et 15h (partie II) d'exercices des cours I et II. Titulaire du cours : P. Damman)

          Rappels de probabilités et statistique + quelques applications
        • Élasticité du caoutchouc et modèle conformationnel élémentaireplugin-autotooltip__default plugin-autotooltip_bigÉlasticité du caoutchouc et modèle conformationnel élémentaire

          Aspect thermodynamique

          Une bande élastique de caoutchouc, polymère naturel dont on peut obtenir un équivalent synthétique par polymérisation de l'isoprène, peut être modélisée à la manière d'un gaz en utilisant des variables analogues au volume et à la pression :$\tau$$\delta W=-pdV$$C_V$$C_p$
        • Conformères d'alcanes linéaires : statistiques et entropie configurationnelleplugin-autotooltip__default plugin-autotooltip_bigConformères d'alcanes linéaires : statistiques et entropie configurationnelle

          Énoncé :

          Une chaîne polymère synthétisée à partir d'éthylène, ou un alcane linéaire sont constitués d'une chaine hydrocarbonée aliphatique linéaire composée de N atomes de carbone.
        • Gaz imparfaitplugin-autotooltip__default plugin-autotooltip_bigGaz imparfait

          * Rappel du cours (partie 2b(bis) Étude statistique des gaz, slides 21 à 32) * Somme d'état de l'ensemble canonique * Énergie cinétique et gaz parfait * Énergie potentielle et interactions entre particules

          * Factorisation
        • Marche aléatoire asymétrique à 1D (grand nombre de pas)plugin-autotooltip__default plugin-autotooltip_bigMarche aléatoire asymétrique à 1D (grand nombre de pas)

          Énoncé

          On considère un réseau unidimensionnel caractérisé par des sites distants de a. Un atome transite d'un site à un voisin chaque τ secondes. Les probabilités sont p (transitions vers la droite) et
        • Gaz d'électronsplugin-autotooltip__default plugin-autotooltip_bigGaz d'électrons

          Rappels de théorie

          * Ensemble grand canonique : variables, somme d'état, probabilités,... * Relations avec la thermodynamique * Électrons et statistique de Fermi-Dirac * ...

          Gaz bidimensionnel : le graphite

          Dans le graphite, les atomes sont situés dans des plans parallèles et des électrons des orbitales π peuvent être considérés comme délocalisés et formant un gaz d'électrons bidimensionnel. La longueur de la liaison C-C vaut 0.142 nm.$p$$p + dp$$\epsilon$$\epsilon +…
        • Moyennes concernant des déplacements de véhiculesplugin-autotooltip__default plugin-autotooltip_bigMoyennes concernant des déplacements de véhicules

          Énoncés

          Automobile à vitesse variable

          Soit une automobile se déplaçant pendant 20 minutes à 60 km/heure, ensuite 20 minutes à 120 km/heure et finalement 20 minutes à 90 km/heure. Le long du trajet, un radar est placé à chaque kilomètre.
        • Séquences de protéinesplugin-autotooltip__default plugin-autotooltip_bigSéquences de protéines

          FIXME : à compléter...

          Calculer le nombre total de brins différents d'ARN à partir duquel il est possible d'obtenir une séquence protéinique donnée.
        • Entropie de translationplugin-autotooltip__default plugin-autotooltip_bigEntropie de translation

          $$\Omega = \frac{1}{h^{3N}} \frac{V^{N}}{N!}\frac{(2\pi mE)^{\frac{3N}{2}}}{(\frac{3N}{2})!} \delta E$$
        • Lancer de plusieurs désplugin-autotooltip__default plugin-autotooltip_bigLancer de plusieurs dés

          * On lance 2 dés et on fait la somme des valeurs obtenues * Quelles sont les valeurs possibles des sommes * Ont-elles toutes la même probabilité d'apparition ? * Quelle est la somme la plus probable ? * Quelle est la somme la moins probable ?
        • Simulations numériques de marches aléatoiresplugin-autotooltip__default plugin-autotooltip_bigSimulations numériques de marches aléatoires

          La marche aléatoire est une formalisation mathématique du comportement sans mémoire d'un objet qui se déplace par pas successifs dans des directions quelconques.

          Imaginez un ivrogne se déplaçant complètement au hasard. La question que les scientifiques se posent est
        • PhysicoChimie II (exercices)plugin-autotooltip__default plugin-autotooltip_bigPhysicoChimie II (exercices)

          Bachelier en sciences chimiques, troisième année, 30 H exercices du cours (titulaire du cours : P. Damman).

          Rappels de probabilités et statistique + quelques applications

          Évènements, probabilités : définitions

          $\Omega$$E_i$$p(E_i)$$0
        • TP de simulations de Monte-Carlo, 2019plugin-autotooltip__default plugin-autotooltip_bigTP de simulations de Monte-Carlo, 2019

          Séances organisées et gérées par Denis Dumont

          Questions

          1D Random Walk :

          Montrer que la marche aléatoire conduit à des distributions de déplacements équivalente à ce qu'on observe pour la diffusion de composés chimiques.
        • Cube de Rubik et couleursplugin-autotooltip__default plugin-autotooltip_bigCube de Rubik et couleurs

          * Rubik's Cube

          * On plonge un Rubik’s cube 8x8x8 entièrement dans un pot de peinture. * Combien de cubes élémentaires ont au moins une face peinte ? * Généraliser pour un cube à c différents de 8. * Comment effectuer ce calcul efficacement ?
        • Flacons défectueux dans une productionplugin-autotooltip__default plugin-autotooltip_bigFlacons défectueux dans une production

          Énoncé

          * Dans une chaîne de production de produits pharmaceutiques, un flacon sur 100 est défectueux. On constitue un colis destiné à une pharmacie centrale avec un seul conditionnement de 100 pièces en prélevant aléatoirement 100 flacons dans la chaîne (la production est largement supérieure à 100). Quelle est la probabilité d’avoir
        • Gaz de photonsplugin-autotooltip__default plugin-autotooltip_bigGaz de photons

          Au XIXe siècle, le rayonnement lumineux a fait l'objet d'études :

          * Loi de Wien (1896) * Loi de Rayleigh-Jeans (1900)

          Les photons suivent les hypothèses suivantes :

          * ils se déplacent à la vitesse de la lumière c dans le vide * sont des bosons * ont une masse nulle au repos$\nu$$h \nu$$h\nu /c$$h/ \lambda = \hbar \mathbf{k}$$\mathbf{k}$
        • TP (simulation) de thermodynamique "équation d'état d'un systèmes de sphères dures"plugin-autotooltip__default plugin-autotooltip_bigTP (simulation) de thermodynamique "équation d'état d'un systèmes de sphères dures"

          Source : TP de thermodynamique Vincent Démery, ESPCI, exercice 1 : Équation d'état

          Il s’agit de simulations de sphères dures (3D) montrant la transition gaz-cristal quand la fraction volumique $\phi$$\phi$
        • Comparaison microcanonique-canonique, vibrateurs et cristal d'Einstein : réponses aux questionsplugin-autotooltip__default plugin-autotooltip_bigComparaison microcanonique-canonique, vibrateurs et cristal d'Einstein : réponses aux questions

          Énoncé : cv_vibration_einstein

          Comparaison des mesures de chaleur spécifique massique de quelques solides à température et pression ambiante (25 C et 1 atm)

          Comment ramener ces valeurs à une base de comparaison commune ? $C_P - C_V = T {V \alpha^2 \over \chi_T}$$E_n = \left(n+\frac{1}{2} \right)h\nu$$n$$\Omega$$E$$S = k_B \log \Omega$$n_i$$\frac{1}{T} = \left(\frac{\partial S}{\partial E}\right)_{V…
        • Lancers consécutifs d'un déplugin-autotooltip__default plugin-autotooltip_bigLancers consécutifs d'un dé

          * Quelle est la probabilité d'avoir au moins une fois un “6” en lançant un dé consécutivement deux fois ? * Quelle est la probabilité d'avoir au moins une fois un “6” en lançant un dé consécutivement trois fois ?$n$
        • Lancers de pièces ("pile ou face")plugin-autotooltip__default plugin-autotooltip_bigLancers de pièces ("pile ou face")

          On considère des lancers de pièces, “pile ou face” ("Coin flipping", “coin tossing”, or “heads or tails” en anglais), en faisant l'hypothèse d'une probabilité égale d'occurrence des 2 possibilités.

          * expérimenter à l'aide de pièces, par exemple faire des séries de 10 lancers (ou lancers de 10 pièces) en comptabilisant les nombres de
        • Tirage d'une carteplugin-autotooltip__default plugin-autotooltip_bigTirage d'une carte

          Considérant un jeu de carte classique de 52 cartes à 13 valeurs et 4 couleurs qui, exposées à un choix au hasard, montrent uniquement 52 dos indiscernables.

          Les couleurs sont deux rouges (coeur et carreau) et 2 noires (trèfle et pique). Les valeurs sont des nombres de 1 (as) à 10 et des figures (valet, dame et roi).
        • Plus ça rate, plus on a de chances que ça marcheplugin-autotooltip__default plugin-autotooltip_bigPlus ça rate, plus on a de chances que ça marche

          Exercice basé sur cette devise “Shadoks”, et pas seulement :

          Réf :

          Questions

          * Combien d'essais seront-ils nécessaires, en moyenne, pour obtenir une réussite, si la probabilité élémentaire de réussite pour un essai vaut $p$$p$$q = 1-p$$p$$(1-p) p$$(1-p)^2 p$$(1-p)^3 p$$(1-p)^4 p$$(1-p)^{i-1} p$$(1-p) p$$$m = 1 p + 2 (1-p) p + 3 (1-p)^2 p + 4 (1-p)^3 p + 5 (1-p)^4 p + \ldots$$$p$$q =…
        • Entropie gazeuse d'alcalins et de gaz raresplugin-autotooltip__default plugin-autotooltip_bigEntropie gazeuse d'alcalins et de gaz rares

          On s'intéresse à l'entropie molaire de gaz, en particulier d'atomes d'alcalins et de gaz rares, dont on dispose de valeurs tabulées (ramenées à 298.15 K et 1 atm, les conditions ambiantes de température et de pression). La masse des atomes est aussi tabulée.
        • Exercices simples sur l'entropie configurationelleplugin-autotooltip__default plugin-autotooltip_bigExercices simples sur l'entropie configurationelle

          * A partir de mesures expérimentales et de calculs théoriques, des chercheurs ont proposé pour borne inférieure de l'entropie d'un cristal d'éthylène la valeur $0~J~K^{-1}~\mbox{mol}^{-1}$ et ont montré qu'on pouvait obtenir une valeur arbitrairement proche de zéro pour un cristal d'éthylène.$CH_2CD_2$$5.763~ J\!K^{-1}\mbox{mol}^{-1}$$CH_2CD_2$$CH_2CD_2$$CD_2CH_2$$0~J~K^{-1}~\mbox{mol}^{-1}$$CH_3D$$11.526~J~K^{-1}~\mbox{mol}^{-1}$$A$$B$$C$$A,…
        • Séquences de brins d'ADNplugin-autotooltip__default plugin-autotooltip_bigSéquences de brins d'ADN

          L'ADN (acide désoxyribonucléique) est constitué d'une suite de nucléotides qui existent en quatre types différents (notés A, C, G et T), du nom des bases adénine (A), cytosine (C), guanine (G) et thymine (T). Les brins s'associent en double hélice par une reproduction assurant une correspondance par paires, A et T d'une part, G et C d'autre part.
        • Rotation de molécules biatomiquesplugin-autotooltip__default plugin-autotooltip_bigRotation de molécules biatomiques

          On s'intéresse à la rotation de molécules biatomiques homo-nucléaires ou hétéro-nucléaires, et à la relation entre la température et les taux d'occupations des états de différentes énergies.

          Les états et énergies $E_{rot} = J(J+1) \frac{h^2}{8 \pi^2 I} \ \ \ \ \ J=0,1,2,\ldots \,$$E_{rot} = J(J+1) \frac{\hbar^2}{2 \mu r_{0}^2} \ \ \ \ \ J=0,1,2,\ldots \,$$E_{rot} = J(J+1) k_B \theta_{rot} \ \ \ \ \ J=0,1,2,\ldots \,$$E_{rot} = J(J+1) h c B_{rot} \ \ \ \ \ J=0,…
        • Dénombrement d'interactions entre atomesplugin-autotooltip__default plugin-autotooltip_bigDénombrement d'interactions entre atomes

          En mécanique moléculaire, on utilise souvent des champs de force privilégiant les interactions par paires, qui permettent de calculer des énergies configurationnelles comportant des contributions d'interactions entre atomes liés (énergies liées aux variations de la longueur de liaison et de l'angle entre deux liaisons consécutives) et entre atomes non liés.$n(n-5)/2$
        • Marche aléatoire symétrique à 1D (nombre réduit de pas)plugin-autotooltip__default plugin-autotooltip_bigMarche aléatoire symétrique à 1D (nombre réduit de pas)

          Énoncé

          Soit un marcheur initialement à la position 0 et avançant ou reculant aléatoirement d'un mètre à chaque unité de temps, avec la même probabilité (p (avancer) = q (reculer) = 0.5). Les distances sont des valeurs absolues de positions qui, elles, doivent incorporer un signe positif ou négatif.
        • Comparaison microcanonique-canonique, vibrateurs et cristal d'Einsteinplugin-autotooltip__default plugin-autotooltip_bigComparaison microcanonique-canonique, vibrateurs et cristal d'Einstein

          Les mesures de chaleur spécifique massique de quelques solides à température et pression ambiante (25 C et 1 atm) donnent ces résultats :

          * Comment ramener ces valeurs à une base de comparaison commune ?
        • Paradoxe des anniversairesplugin-autotooltip__default plugin-autotooltip_bigParadoxe des anniversaires

          Énoncé

          * Quelle est la probabilité qu'au moins deux personnes aient leur anniversaire le même jour dans un groupe de 40 personnes ?

          Solution

          Il est plus simple de passer par le calcul de la probabilité complémentaire Pcomp(N), que toutes les N personnes présentes aient leur anniversaire des jours différents. Si on considère une personne à la fois, on multipliera les probabilités indépendantes d'$1-\frac{N!/(N-k)!}{N^k}$
        • Poker menteurplugin-autotooltip__default plugin-autotooltip_bigPoker menteur

          Au poker menteur, on utilise 5 dés avec des valeurs de 1 à 6, ou 9, 10, valet, dame roi et as.

          * En lançant les 5 dés, on peut obtenir des combinaisons particulières classables dans un ordre conventionnel : * rien * une paire * deux paires
        • Lancer d'un dé polyédriqueplugin-autotooltip__default plugin-autotooltip_bigLancer d'un dé polyédrique

          Cela fait longtemps qu'on utilise des dès, et pas toujours à 6 faces ! (cf. Faience polyhedron inscribed with letters of the Greek alphabet,2nd–3rd century A.D.

          Énoncé

          * On lance un dé (normal, 6 faces carrées équiprobables) * Quelle est la probabilité que le résultat soit pair ? * Quelle est la probabilité que le résultat soit divisible par 3 ?
        • Synthèse de molécules en étoile : statistiquesplugin-autotooltip__default plugin-autotooltip_bigSynthèse de molécules en étoile : statistiques

          Énoncé :

          On synthétise des molécules en étoile à partir de molécules CA4, BCD2, ECF où A, B, D et F représentent des groupements réactifs.

          Par réaction, des liaisons chimiques A-B, et D-E peuvent se former avec respectivement des probabilités p et q.
        • Rappels de probabilités et statistique + quelques applicationsplugin-autotooltip__default plugin-autotooltip_bigRappels de probabilités et statistique + quelques applications

          Évènements, probabilités : définitions

          * Épreuve ou expérience aléatoire : processus dont le résultat est incertain (tirage au hasard , jets de pièces, de dès,...) * Évènement$\Omega$$E_i$$p(E_i)$$0
      • Examen de l'efficacité d'un format d'apprentissage en "classe inversée" semi-stimulé dans une séquence de chimie généraleplugin-autotooltip__default plugin-autotooltip_bigExamen de l'efficacité d'un format d'apprentissage en "classe inversée" semi-stimulé dans une séquence de chimie générale

        Article Examining the Effectiveness of a Semi-Self-Paced Flipped Learning Format in a College General Chemistry Sequence Lisa Hibbard, Shannon Sung, and Breché Wells, J. Chem. Educ., 2016, 93 (1), pp 24–30 DOI: 10.1021/acs.jchemed.5b00592 résumé de H.D. 2016-2017
      • Publications intéressantesplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes

        Dans Journal of Chemical Education

        2020

        FIXME

        2019

        * Total Chemical Footprint of an Experiment: A Systems Thinking Approach to Teaching Rovibrational Spectroscopy Paul D. Cooper, Jacob Walser, J. Chem. Educ. 2019, 96(12), 2947-2951 DOI: 10.1021/acs.jchemed.9b00405 * Valorization of Waste Orange Peel to Produce Shear-Thinning Gels Lucy S. Mackenzie, Helen Tyrrell, Robert Thomas, Avtar S. Matharu, James H. Clark, Glenn A. Hurst, J. Chem. Educ. 2019, 96(12), 3025…
      • Apprendre le concept d’équilibre chimique aux élèves de secondaireplugin-autotooltip__default plugin-autotooltip_bigApprendre le concept d’équilibre chimique aux élèves de secondaire

        A Teaching Sequence for Learning the Concept of Chemical Equilibrium in Secondary School Education Marco Ghirardi, Fabio Marchetti, Claudio Pettinari, Alberto Regis, and Ezio Roletto, J. Chem. Educ., 2014, 91 (1), pp 59–65 DOI: 10.1021/ed3002336 résumé de J.V. 2014-2015
      • Comment motiver les étudiants à étudier avant un laboratoireplugin-autotooltip__default plugin-autotooltip_bigComment motiver les étudiants à étudier avant un laboratoire

        How To Motivate Students To Study before They Enter the Lab, Lea Pogacnik et Blaz Cigic, J. Chem Ed. Vol. 83 No. 7 Augustus 2006, pp 1094-1098) Résumé de A.W, 2006-2007

        Des études ont montré que les étudiants ne préparent pas suffisamment leur séances de laboratoire pendant leurs études supérieures et consacrent généralement plus de temps aux activités post-laboratoire telles que la rédaction des rapports. Il a été remarqué également…
      • Une expérience médico-légale : le cas du crime au cinémaplugin-autotooltip__default plugin-autotooltip_bigUne expérience médico-légale : le cas du crime au cinéma

        Article : A Forensic Experiment: The Case of the Crime at the Cinema J. M. Valente Nabais and Sara D. Costa, J. Chem. Educ., 2017, 94 (8), pp 1111–1117 DOI: 10.1021/acs.jchemed.6b00942 résumé de A.D. 2017-2018

        Introduction

        Cet article rapporte une activité expérimentale où les étudiants doivent analyser attentivement les preuves recueillies sur le lieu d’un crime, à savoir des fibres et des traces de rouge à lèvres. Les fibres sont a…
      • Expérience de la bouteille bleue : Apprendre la chimie sans connaître les produits chimiquesplugin-autotooltip__default plugin-autotooltip_bigExpérience de la bouteille bleue : Apprendre la chimie sans connaître les produits chimiques

        Article Blue Bottle Experiment: Learning Chemistry without Knowing the Chemicals T. Limpanuparb , C. Areekul, P. Montriwat, and U. Rajchakit, J. Chem. Educ., 2017, 94 (6), pp 730–737 DOI: 10.1021/acs.jchemed.6b00844 résumé de F.P. 2017-2018
      • Quoraplugin-autotooltip__default plugin-autotooltip_bigQuora

        * What ALL are EXCEPTIONS in chemical BONDING? * ...
      • Animations sur ordinateur de phénomènes chimiques à l'échelle moléculaireplugin-autotooltip__default plugin-autotooltip_bigAnimations sur ordinateur de phénomènes chimiques à l'échelle moléculaire

        Chemists' Guide to Effective Teaching, Volume II, Norbert J. Pienta, Melanie M. Cooper & Thomas J. Greenbowe, Prentice Hall, 2008, ISBN 9780321611956 - Chapter 14: Computer Animations of Chemical Processes at the Molecular Level (Résumé de S.P., 2013-2014)
      • Quantification des concentrations de protéines à l'aide de la colorimétrie par un Smartphone: une nouvelle méthode pour un test établiplugin-autotooltip__default plugin-autotooltip_bigQuantification des concentrations de protéines à l'aide de la colorimétrie par un Smartphone: une nouvelle méthode pour un test établi

        Article: Quantifying Protein Concentrations Using Smartphone Colorimetry: A New Method for an Established Test T. Gee, Eric Kehoe, William C. K. Pomerantz, and R. Lee Penn, J. Chem. Educ., 2017, 94 (7), pp 941–945 DOI: 10.1021/acs.jchemed.6b00676 résumé de A.O. 2017-2018
      • Les perceptions des élèves concernant l'utilisation de jeux éducatifs comme outil pour enseigner le tableau périodique des éléments au niveau secondaireplugin-autotooltip__default plugin-autotooltip_bigLes perceptions des élèves concernant l'utilisation de jeux éducatifs comme outil pour enseigner le tableau périodique des éléments au niveau secondaire

        Articles Students’ Perceptions about the Use of Educational Games as a Tool for Teaching the Periodic Table of Elements at the High School Level Antonio Joaquín Franco-Mariscal, José María Oliva-Martínez, and M. L. Almoraima Gil, J. Chem. Educ., 2015, 92 (2), pp 278–285 DOI: 10.1021/ed4003578 résumé de G.V. 2015-2016
      • Les acides donnent-ils vraiment un proton ?plugin-autotooltip__default plugin-autotooltip_bigLes acides donnent-ils vraiment un proton ?

        * Cf. chemistry.stackexchange : Do acids really donate a proton? * Question gérée par S.N., étudiant 2019-2020

        Développement

        (lignes de développement uniquement - ici figurent qques mots clefs et symboles de type (..) pour définir les lignes directrices de l'argumentaire/l'explication)
      • Zététiqueplugin-autotooltip__default plugin-autotooltip_bigZététique

        Qu’est ce que la zététique ?

        La réponse de Jean-Michel Abrassart

        * * lien youtube

        Résumé de Rémi Magnouat, avec le préambule suivant : Dans cet épisode du podcast vidéo « scepticisme scientifique », Jean-Michel Abrassart aborde le sujet de la perception de la Zététique et de la définition qui lui est donnée. J'ai été particulièrement intéressé par cet épisode car je me suis souvent questionné su…
      • Exploration du contexte quotidien des éléments chimiques : Découvrir les éléments des composants automobilesplugin-autotooltip__default plugin-autotooltip_bigExploration du contexte quotidien des éléments chimiques : Découvrir les éléments des composants automobiles

        Article Exploring the Everyday Context of Chemical Elements: Discovering the Elements of Car Components Antonio Joaquín Franco-Mariscal, J. Chem. Educ., 2015, 92 (10), pp 1672–1677 DOI: 10.1021/acs.jchemed.5b00164 résumé de L.R. 2016-2017
      • Applications intéressantesplugin-autotooltip__default plugin-autotooltip_bigApplications intéressantes

        * Zeer ou le Frigo du Désert * Efficacité énergétique des transports (vivant, machines,...)
      • Mercureplugin-autotooltip__default plugin-autotooltip_bigMercure

        FIXME

        * Spiraling 'demon' reaction
      • Chemistry Education Research and Practice : fil RSS des derniers articlesplugin-autotooltip__default plugin-autotooltip_bigChemistry Education Research and Practice : fil RSS des derniers articles

        Chemistry Education Research and Practice : fil RSS des derniers articles
      • Agendaplugin-autotooltip__default plugin-autotooltip_bigAgenda

        Activités diverses liées à l'enseignement directement ou indirectement, par ordre chronologique

        2018-10-20 : Playful Science 12

        * Pour mémoire, le festival se déroulera dans le bâtiment S de l’ULB, avenue Jeanne, 44 - 1050 – Bruxelles, le samedi 20 octobre 2018 de 9 h à 17 h.
      • Implémentation d’une séquence didactique sur la loi de l’équilibre chimique à l'intention d'élèves du secondaireplugin-autotooltip__default plugin-autotooltip_bigImplémentation d’une séquence didactique sur la loi de l’équilibre chimique à l'intention d'élèves du secondaire

        Article Implementing an Equilibrium Law Teaching Sequence for Secondary School Students To Learn Chemical Equilibrium Marco Ghirardi, Fabio Marchetti, Claudio Pettinari, Alberto Regis, and Ezio Roletto, J. Chem. Educ., 2015, 92 (6), pp 1008–1015 DOI: 10.1021/ed500658s Résumé de C.M. 2015-2016$\frac{[C]^x[D]^y}{[A]^m[B]^n} = \frac{k_{directe}}{k_{inverse}} = K_{eq}$
      • Touchez vite! Jouer à un jeu de symétrie moléculaire pour une évaluation pratique et formative de la compréhension des concepts de symétrie par les étudiantsplugin-autotooltip__default plugin-autotooltip_bigTouchez vite! Jouer à un jeu de symétrie moléculaire pour une évaluation pratique et formative de la compréhension des concepts de symétrie par les étudiants

        Article : Tap It Fast! Playing a Molecular Symmetry Game for Practice and Formative Assessment of Students’ Understanding of Symmetry Concepts Ricardo Dagnoni Huelsmann, Andrei Felipe Vailati, Lucas Ribeiro de Laia, Patrícia Salvador Tessaro, and Fernando Roberto Xavier, J. Chem. Educ., 2018, 95 (7), pp 1151–1155 DOI: 10.1021/acs.jchemed.7…
      • Amélioration de l'enseignement primaire et secondaire par la science et l'ingénierie des polymèresplugin-autotooltip__default plugin-autotooltip_bigAmélioration de l'enseignement primaire et secondaire par la science et l'ingénierie des polymères

        Article Augmenting Primary and Secondary Education with Polymer Science and Engineering Rose K. Cersonsky, Leanna L. Foster, Taeyong Ahn, Ryan J. Hall, Harry L. van der Laan, and Timothy F. Scott, J. Chem. Educ., 2017, 94 (11), pp 1639–1646 DOI: 10.1021/acs.jchemed.6b00805 résumé de G.H. 2017-2018
      • Quel volume occupe une mole de gaz idéal ?plugin-autotooltip__default plugin-autotooltip_bigQuel volume occupe une mole de gaz idéal ?

        * Sources * What volume does one mole of an ideal gas occupy? * contribution de E.K., étudiante AESS 2018-2019 * Socratic Q&A Chemistry : What causes gas pressure (in terms of kinetic theory)?

        Avant de répondre à cette question, il serait nécessaire de définir un gaz idéal, encore appelé « gaz parfait ». Les gaz doivent répondre à deux conditions afin d’être définis comme parfait.
      • Enseigner la chimie organique via la taxonomie de Bloom ?plugin-autotooltip__default plugin-autotooltip_bigEnseigner la chimie organique via la taxonomie de Bloom ?

        Teaching Introductory Organic Chemistry: “Blooming beyond a Simple Taxonomy, M.D. Pungente, R.A. Badger, J.Chem.Educ., 2003, 80, 779. Résumé de D.F. 2010-2011. Article d'intérêt didactique

        Introduction

        Souvent, la chimie organique est vue pour la plupart des élèves comme la bête noire des sciences. Ils doivent s’accrocher toute l’année pour passer et espèrent mémoriser suffisamment pour réussir ce cours. Les élèves s’inscrivent en chim…
      • À quoi servent les savoirs scolaires ?plugin-autotooltip__default plugin-autotooltip_bigÀ quoi servent les savoirs scolaires ?

        Conférence de Bernard Rey, Charleroi, avril 2016

        Annonce :

        * Les Cafés Conférences de l’Échevinat de l’enseignement de la Ville de Charleroi, en partenariat avec le Centre de Culture scientifique de l’ULB, l’UAE Charleroi-Le Centre , l’Extension de l’ULB, La Ligue de l’Enseignement et de l’Education permanente et Charleroi Danses proposent une conférence de Bernard Rey, Docteur en Sciences de l’Éducation et Professeur honoraire à l’ULB…
      • Questions et réponses en chimie sur chemistry.stackexchangeplugin-autotooltip__default plugin-autotooltip_bigQuestions et réponses en chimie sur chemistry.stackexchange

        Chemistry Stack Exchange est un site de questions et réponses pour les scientifiques, les enseignants, les étudiants,... Il est gratuit, est son contenu est sous licence libre (copyleft) Creative Commons BY-SA. Aucune inscription n'est requise pour la consultation. Vous devez vous identifier pour y contribuer. Le fonctionnement est réglé par un système de
      • reglementaessplugin-autotooltip__default plugin-autotooltip_bigPage déplacée ici :
      • Ces chimistes de pharaonsplugin-autotooltip__default plugin-autotooltip_bigCes chimistes de pharaons

        Chemistry in the time of the pharaons, Peter Loyson, Journal of Chemical Education, 2011, 88 (2), pp 146–150. Résumé de N.L. 2010-2011).

        Les pharaons, une longueur d’avance !

        Grâce à l’abondance des ressources naturelles de l’Egypte (ex : les minéraux, pierres précieuses et usuelles) et à leur ingéniosité, les anciens Egyptiens ont été des pionniers dans beaucoup de domaines comme par exemple :
      • Chimie – Sciences générales – UAA 6 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 6 – Troisième degré

        Caractériser un phénomène chimique

        Compétences à développer

        * Caractériser la vitesse de réaction sur base de critères qualitatifs * Caractériser l’effet thermique d’un phénomène chimique
      • Psychologie de l'éducationplugin-autotooltip__default plugin-autotooltip_bigPsychologie de l'éducation

        Thèmatiques reliées : neurosciences, cognition/métacognition, motivation,...

        Principes fondamentaux

        * Comment pensent et apprennent les élèves ? * PRINCIPE 1 - Les convictions et perceptions de l’élève sur son intelligence et ses aptitudes influencent son mode de fonctionnement cognitif et son apprentissage.
      • CAPAES chimie
        • Une (autre) modification de la démonstration de la fontaine ammoniacaleplugin-autotooltip__default plugin-autotooltip_bigUne (autre) modification de la démonstration de la fontaine ammoniacale

          Article A(nother) Modification of the Ammonia Fountain Demonstration Ben Ruekberg and David L. Freeman, J. Chem. Educ., 2017, 94 (10), pp 1397–1398 DOI: 10.1021/acs.jchemed.7b00295 résumé de G.H. 2017-2018

          + Le texte complet

          Cet article, publié dans le
        • Initiation à l'informatiqueplugin-autotooltip__default plugin-autotooltip_bigInitiation à l'informatique

          Cours libre en ligne à destination des étudiants de la section chimie. Si vous avez des questions ou souhaits de compléments d'informations, ou d'ajouts de rubriques, vous pouvez utiliser ce formulaire de contact.

          Les bases de l'informatique
        • testplugin-autotooltip__default plugin-autotooltip_bigtest

          test
        • Détermination de l'acidité titrable dans le vin à l'aide de méthodes potentiométriques, conductimétriques et photométriquesplugin-autotooltip__default plugin-autotooltip_bigDétermination de l'acidité titrable dans le vin à l'aide de méthodes potentiométriques, conductimétriques et photométriques

          Article : Determination of Titratable Acidity in Wine Using Potentiometric, Conductometric, and Photometric Methods Dietrich A. Volmer, Luana Curbani, Timothy A. Parker, Jennifer Garcia, Linda D. Schultz, and Endler Marcel Borges, J. Chem. Educ., 2017, 94 (9), pp 1296–1302 DOI: 10.1021/acs.jchemed.6b00891 résumé de J.D. 2017-2018
        • Carboneplugin-autotooltip__default plugin-autotooltip_bigCarbone

          Diamant

          Graphite

          * fr:Mersen : En 1893, Charles Street, ingénieur chez Le Carbone, découvre et brevète le procédé de la graphitation du carbone qui permet la fabrication de graphite synthétique * En 2019, 9,41 millions de dollars australiens d'aides ont été attribués pour un projet de conversion du biogaz (ici issu de méthanisation de boues d’épuration) en graphite et en hydrogène. (cf.
        • Cuivreplugin-autotooltip__default plugin-autotooltip_bigCuivre

          Patine du cuivre exposé aux conditions atmosphériques

          * * * * * *
        • Activités d'enseignement en chimie-physiqueplugin-autotooltip__default plugin-autotooltip_bigActivités d'enseignement en chimie-physique

          Cours, exercices et stages :

          * Thermodynamique (bachelier en sciences chimiques, deuxième année, 30 H cours, 30 H exercices et 30 H travaux pratiques, en co-suppléance avec P. Damman et S. Gabriele)
        • Combien de temps les étudiants peuvent-ils prêter attention en classe ? Une étude de la baisse d’attention de l’étudiant en utilisant des clickersplugin-autotooltip__default plugin-autotooltip_bigCombien de temps les étudiants peuvent-ils prêter attention en classe ? Une étude de la baisse d’attention de l’étudiant en utilisant des clickers

          How Long Can Students Pay Attention in Class? A Study of Student Attention Decline Using Clickers, D.M. Bunce, E.A. Flens and K.Y. Neiles, Journal of Chemical Education, 2010, 87(12), 1438-1443. Résumé de S.S., 2010-2011.
        • Quelles tailles et capacités de batteries électriques pour assurer l'utilisation d'énergies renouvelablesplugin-autotooltip__default plugin-autotooltip_bigQuelles tailles et capacités de batteries électriques pour assurer l'utilisation d'énergies renouvelables

          Le stockage énergétique est nécessaire dans le cadre d'une transition vers 100% d'énergie renouvelable. Si l'énergie hydroélectrique peut être utilisée à volonté (pilotable), ce n'est pas le cas des productions d'électricité via les éoliennes et les panneaux photo-voltaïques qui sont de plus en plus installés.
        • Le choc des chimistes: un blog gamifié pour maîtriser le concept de la stœchiométrie des réactifs limitantsplugin-autotooltip__default plugin-autotooltip_bigLe choc des chimistes: un blog gamifié pour maîtriser le concept de la stœchiométrie des réactifs limitants

          Article : Clash of Chemists: A Gamified Blog To Master the Concept of Limiting Reagent Stoichiometry, Nathalie V. le Maire, Dominique Ph. Verpoorten, Marie-Laure S. Fauconnier, and Catherine G. Colaux-Castillo, Journal of Chemical Education Article
        • Dissolution de sels dans l'eau : explications particulaires par les élèves des changements de températureplugin-autotooltip__default plugin-autotooltip_bigDissolution de sels dans l'eau : explications particulaires par les élèves des changements de température

          Article Dissolving Salts in Water: Students’ Particulate Explanations of Temperature Changes Timothy N. Abell and Stacey Lowery Bretz, J. Chem. Educ., 2018, 95 (4), pp 504–511 DOI: 10.1021/acs.jchemed.7b00845 résumé de S.V. 2017-2018
        • Variations sur la démonstration de la "bouteille bleue" avec des aliments contenant un colorant bleuplugin-autotooltip__default plugin-autotooltip_bigVariations sur la démonstration de la "bouteille bleue" avec des aliments contenant un colorant bleu

          Variations on the “Blue-Bottle” Demonstration Using Food Items That Contain FD&C Blue #1 Felicia A. Staiger, Joshua P. Peterson, and Dean J. Campbell, J. Chem. Educ., 2015, 92 (10), pp 1684–1686 DOI: 10.1021/acs.jchemed.5b00190 résumé de C.D. 2015-2016
        • Un laboratoire utilisant des modèles moléculaires pour une introduction en chimieplugin-autotooltip__default plugin-autotooltip_bigUn laboratoire utilisant des modèles moléculaires pour une introduction en chimie

          A laboratory experiment using molecular models for an introductory chemistry class, Shahrokh Ghaffari, J. Chem Ed. Vol. 83 No. 8 Augustus 2006, pp 1182-1184. Sur base d'un résumé de C. B., AESS 2006-2007.

          Depuis le milieu du 19ème siècle, l’utilisation de modèles moléculaires est de plus en plus répandue tant dans la recherche scientifique que dans l’enseignement des sciences. En effet, on trouve dans quasi tous …
        • Développement d’un test à trois niveaux comme outil de diagnostic valide pour l’identification de fausses conceptions sur les glucidesplugin-autotooltip__default plugin-autotooltip_bigDéveloppement d’un test à trois niveaux comme outil de diagnostic valide pour l’identification de fausses conceptions sur les glucides

          Article Development of a Three-Tier Test as a Valid Diagnostic Tool for Identification of Misconceptions Related to Carbohydrates, Dušica D. Milenković, Tamara N. Hrin, Mirjana D. Segedinac, and Saša Horvat, J. Chem. Educ., 2016, 93 (9), pp 1514–1520 DOI: 10.1021/acs.jchemed.6b00261 résumé de H.D. 2016-2017
        • Chimie – Sciences de base – UAA 1 – Deuxième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 1 – Deuxième degré

          Constitution et classification de la matière

          Compétences à développer

          * Décrire et modéliser les différents niveaux d’organisation de la matière * Analyser le tableau périodique des éléments pour en extraire des informations pertinentes
        • Analyse et identification des principaux acides organiques dans les vins et les jus de fruits par chromatographie sur papierplugin-autotooltip__default plugin-autotooltip_bigAnalyse et identification des principaux acides organiques dans les vins et les jus de fruits par chromatographie sur papier

          Article Analysis and Identification of Major Organic Acids in Wine and Fruit Juices by Paper Chromatography Dulani Samarasekara, Courtney Hill, and Deb Mlsna, J. Chem. Educ., 2018, 95 (9), pp 1621–1625 DOI: 10.1021/acs.jchemed.8b00129 résumé de A.M. 2018-2019
        • Intégration des représentations de particules dans la chimieplugin-autotooltip__default plugin-autotooltip_bigIntégration des représentations de particules dans la chimie

          Integrating Particulate Representations into AP Chemistry and Introductory Chemistry Courses Stephen G. Prilliman, J. Chem. Educ., 2014, 91 (9), pp 1291–1298 DOI: 10.1021/ed5000197 résumé de F.M. 2014-2015, numéro spécial de la revue de septembre 2014, special “AP chemistry curriculum framework”
        • Pourquoi le borax est-il utilisé comme standard primaireplugin-autotooltip__default plugin-autotooltip_bigPourquoi le borax est-il utilisé comme standard primaire

          * Sources : * Chemistry Stackexchange : Why is Borax used as a primary standard? * contribution de E.D., étudiant AESS 2018-2019 * fr:Borax

          Qu’est-ce que le borax ?

          Les borates sont des composés chimiques constitués d’atomes de bore et d’oxygène. Le borax est le nom communément utilisé pour le borate de sodium hydraté de formule brute :
        • Chimie – Sciences de base – UAA 6 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 6 – Troisième degré

          Les équilibres chimiques

          Compétences à développer

          * Prévoir le sens d’évolution d’une réaction réversible

          Processus

          Appliquer

          * Utiliser une table des constantes d’équilibre pour distinguer une réaction complète d’une réaction limitée à un équilibre
        • Enseigner aux étudiants débutants en chimie les structures de Lewis simplesplugin-autotooltip__default plugin-autotooltip_bigEnseigner aux étudiants débutants en chimie les structures de Lewis simples

          Article Teaching Beginning Chemistry Students Simple Lewis Dot Structures Peter Nassiff and Wendy A. Czerwinski, J. Chem. Educ., 2015, 92 (8), pp 1409–1411 DOI: 10.1021/ed5007162 résumé de L.R. 2016-2017

          Introduction

          Les structures de Lewis conduisent à la compréhension de la liaison chimique et permettent à l’étudiant de construire des molécules simples. Les étudiants qui débutent l’étude de la chimie ont souvent …
        • Diagrammes sub-microscopiques générés par les élèves : un outil utile pour enseigner et apprendre les équations chimiques et la stœchiométrieplugin-autotooltip__default plugin-autotooltip_bigDiagrammes sub-microscopiques générés par les élèves : un outil utile pour enseigner et apprendre les équations chimiques et la stœchiométrie

          Student-generated submicro diagrams: a useful tool for teaching and learning chemical equations and stoichiometry, Bette Davidowitz, Gail Chittleborough and Eileen Murray, Chemistry Education Research and Practice, 2010, 11, 154-164. Résumé de M.R., 2010-2011.
        • Ligne du Temps de la Chimieplugin-autotooltip__default plugin-autotooltip_bigLigne du Temps de la Chimie

          Préambule

          Toute science progresse par la réalisation et l'interprétation d'expériences, par l'introduction de nouveaux concepts, ... Des améliorations et corrections se succèdent alors, dévoilant parfois des erreurs ou des imprécisions du passé. Dans de nombreuses situations, la recherche scientifique induit des interrogations sur l'articulation des travaux actuels par rapport à la masse des connaissances précédentes. Dès lors, on se rend compte qu'une connaissanc…
        • Classifier la matière : modèle utilisant des attaches-trombonnesplugin-autotooltip__default plugin-autotooltip_bigClassifier la matière : modèle utilisant des attaches-trombonnes

          Classifying matter : a physical model using paper clips, Bob Blake, Lynn Hogue & Jerry L. Sarquis, J. Chem. Ed. Vol. 83 No. 9 September 2006, pp 1317-1318 + supplement). Sur base d'un résumé de K. R., AESS 2006-2007.

          Les élèves ont des difficultés à visualiser le monde des chimistes et leur langage spécifique. Au début de leurs études, les élèves peinent à apprendre et à appliquer la définition des termes
        • Que veulent dire les chimistes lorsqu'ils parlent des éléments ?plugin-autotooltip__default plugin-autotooltip_bigQue veulent dire les chimistes lorsqu'ils parlent des éléments ?

          What Do Chemists Mean When They Talk about Elements? Elena Ghibaudi, Alberto Regis, and Ezio Roletto, J. Chem. Educ., 2013, 90 (12), pp 1626–1631 DOI: 10.1021/ed3004275

          * Certaines incohérences dans la définition de l'élément se retrouvent dans les manuels scolaires et et universitaires, entretenant une confusion entre le concept d'élément et le concept de substance simple, et posant un problème didactique
        • Classe "Escape" : Le processus Leblanc - Un «jeu d'évasion» éducatifplugin-autotooltip__default plugin-autotooltip_bigClasse "Escape" : Le processus Leblanc - Un «jeu d'évasion» éducatif

          Article : Escape Classroom: The Leblanc Process—An Educational "Escape Game" Nicolas Dietrich, J. Chem. Educ., 2018, 95 (6), pp 996–999 DOI: 10.1021/acs.jchemed.7b00690 résumé de A.M. 2018-2019

          Introduction:

          Un escape game pédagogique est un jeu d'évasion virtuel ou non, à réaliser en groupe et construit sur une succession d'énigmes permettant d'atteindre un but. Dans notre cas, il s’agit de trouver des combinaisons de nom…
        • Intégration de senseurs en papier à base de nanoparticules : un exemple d’application pour une analyse colorimétrique rapide d’antioxydantsplugin-autotooltip__default plugin-autotooltip_bigIntégration de senseurs en papier à base de nanoparticules : un exemple d’application pour une analyse colorimétrique rapide d’antioxydants

          Article Integration of Nanoparticle-Based Paper Sensors into the Classroom: An Example of Application for Rapid Colorimetric Analysis of Antioxidants Erica Sharpe and Silvana Andreescu, J. Chem. Educ., 2015, 92 (5), pp 886–891 DOI: 10.1021/ed400851m résumé de G.D. 2015-2016
        • Informatique appliquée (programmation, méthodes numériques,...)plugin-autotooltip__default plugin-autotooltip_bigInformatique appliquée (programmation, méthodes numériques,...)

          Cours, exercices et stages :

          * Programmation appliquée à la chimie (bachelier en sciences chimiques, deuxième année, 15 H cours et 15 H exercices) * Calculation methods applied to chemistry / Méthodes de calcul appliqué à la chimie (1er et 2ème master en sciences chimiques, 15 H cours et 15 H TP, en option)
        • La chimie des produits alimentaires auto-chauffantsplugin-autotooltip__default plugin-autotooltip_bigLa chimie des produits alimentaires auto-chauffants

          The Chemistry of Self-Heating Food Products, Martin T. Oliver-Hoyo, Gabriel Pinto, Juan Antonio Llorens-Molina. Journal of Chemical Education vol. 86, No. 11, November 2009, p1277-1280. Résumé par M.C., 2009-2010

          Les boîtes auto chauffantes ou auto réfrigérantes pour les repas ou les boissons sont d’excellents exemples de l’application de la chimie dans la vie de tous les jours. Ces systèmes sont composés de deux récipients : l’un stocke la n…
        • Un aperçu de la façon dont les élèves apprennent la différence entre un acide faible et un acide fort à partir de tutoriels animés utilisant des visualisationsplugin-autotooltip__default plugin-autotooltip_bigUn aperçu de la façon dont les élèves apprennent la différence entre un acide faible et un acide fort à partir de tutoriels animés utilisant des visualisations

          Article Insights into How Students Learn the Difference between a Weak Acid and a Strong Acid from Cartoon Tutorials Employing Visualizations, Resa M. Kelly and Sevil Akaygun, J. Chem. Educ., 2016, 93 (6), pp 1010–1019 DOI: 10.1021/acs.jchemed.6b00034 résumé de B.D. 2016-2017
        • Le tableau périodique des personnes: Un cadre pour engager les étudiants d'introduction à la chimieplugin-autotooltip__default plugin-autotooltip_bigLe tableau périodique des personnes: Un cadre pour engager les étudiants d'introduction à la chimie

          Article The People Periodic Table: A Framework for Engaging Introductory Chemistry Students Adam Hoffman and Mark Hennessy, J. Chem. Educ., 2018, 95 (2), pp 281–285 DOI: 10.1021/acs.jchemed.7b00226 résumé de A.-C. N. 2018-2019
        • Activités en classe par manipulation de trombones pour introduire les structures et les propriétés des polymèresplugin-autotooltip__default plugin-autotooltip_bigActivités en classe par manipulation de trombones pour introduire les structures et les propriétés des polymères

          Polymer Basics: Classroom Activities Manipulating Paper Clips To Introduce the Structures and Properties of Polymers Yunusa Umar, J. Chem. Educ., 2014, 91 (10), pp 1667–1670 DOI: 10.1021/ed400551c résumé de F.M. 2014-2015

          Pour améliorer la compréhension des concepts de base et la visualisation des structures des polymères, différentes activités peuvent être réalisées en classe en …
        • Redox Concept Inventory (ROXCI)plugin-autotooltip__default plugin-autotooltip_bigRedox Concept Inventory (ROXCI)

          Par Alexandra R. Brandriet et Stacey Lowery Bretz, Université de Miami (une thèse et 2 articles) :

          * Investigating Students' Understandings of the Symbolic, Macroscopic, and Particulate Domains of Oxidation-Reduction and the Development of the Redox Concept Inventory, PhD thesis, Brandriet, Alexandra R, 2014, Miami University * The Development of the Redox Concept Inventory as a Measure of Students’ Symbolic and Particulate Redox Understandings and Confidenc…
        • Chimie – Sciences générales – UAA 1 – Deuxième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 1 – Deuxième degré

          Constitution et classification de la matière

          Compétences à développer

          * Décrire et modéliser les différents niveaux d’organisation de la matière. * Analyser le tableau périodique des éléments pour en extraire des informations pertinentes.
        • L'unité de masse atomique, la constante d'Avogadro et la mole : un moyen de comprendreplugin-autotooltip__default plugin-autotooltip_bigL'unité de masse atomique, la constante d'Avogadro et la mole : un moyen de comprendre

          The Atomic Mass Unit, the Avogadro Constant, and the Mole: A Way To Understanding, Andrzej Baranski, J. Chem. Educ. 2012, 89, 97-102. DOI: 10.1021/ed2001957 Résumé de B.V.A., 2011-2012.

          Le problème

          L’apprentissage des concepts chimiques de base que sont l’unité de masse atomique ou la mole de constituants sont complexes, car les concepts sous-jacents sont sujets à confusion. Ainsi, les définitions existan…
        • Programmation appliquée à la chimieplugin-autotooltip__default plugin-autotooltip_bigProgrammation appliquée à la chimie

          Le cours “Programmation appliquée à la chimie” de bachelier en sciences chimiques (15 H cours et 15 H exercices, bloc2) utilise deux supports :

          * Principalement, le présent wiki pour ses avantages techniques (coloration et indentation du code, recherche dans les pages, historique des modifications,
          • Utilisation d'une "classe" pour des données de solvants chimiquesplugin-autotooltip__default plugin-autotooltip_bigUtilisation d'une "classe" pour des données de solvants chimiques

            On peut utiliser la structure de classe pour créer une “table” de données sur des solvants. Il est alors possible d'effectuer des traitements de tris, sélection, impression...
          • Algorithmes diversplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes divers

            Problèmes résolus :

            * Fizz buzz, jeu de comptage et de divisibilité conçu pour des enfants * ...

            Problèmes non résolus

            * Décomposition de formules chimiques (analyse de chaînes de caractères) * ...

            Classiques

            * Solving Travelling Salesperson Problems with Python

            Références diverses

            *
          • Représentation du potentiel de Lennard-Jonesplugin-autotooltip__default plugin-autotooltip_bigReprésentation du potentiel de Lennard-Jones

            L'utilisation de fonctions en python permet de nombreuses applications par la création de graphiques. En utilisant la “bibliothèque matplotlib/pylab”, vous pourrez donc aisément créer des graphes de fonction.$V_{LJ} = 4\varepsilon \left[ \left(\frac{\sigma}{r}\right)^{12} - \left(\frac{\sigma}{r}\right)^{6} \right] = \varepsilon \left[ \left(\frac{r_{m}}{r}\right)^{12} - 2\left(\frac{r_{m}}{r}\right)^{6} \right]$$r_{m} = 2^{1/6} \sigma$$U_{tot} = \fr…
          • Pylabplugin-autotooltip__default plugin-autotooltip_bigPylab

            Pylab permet de combiner simplement Matplotlib, NumPy et SciPy, en utilisant une directive d'importation supprimant l'usage de tous les namespaces des librairies sous-jacentes :

            from pylab import *

            Exemple

            Version “Pylab” du code utilisé pour la
          • Lire et écrire des fichiers de données csvplugin-autotooltip__default plugin-autotooltip_bigLire et écrire des fichiers de données csv

            pandas Les fichiers csv sont des fichiers de données séparées par des virgules (ou point-virgules), pour “comma separated values”. Comme ceci :

            1;0.1;3 2;0.3;5 3;0.5;7 4;0.6;11 5;0.9;21 6;1.5;39

            Ils peuvent être facilement importés ou exportés de tableurs ou logiciels de graphiques scientifiques.
          • Tableau périodiqueplugin-autotooltip__default plugin-autotooltip_bigTableau périodique

            Tableau avec éléments cliquables pour obtenir les information. Nécessite [ce fichier de données].

            #!/usr/bin/env python # -*- coding: utf-8 -*- # version un peu aménagée du travail de TD et SD, ba2 chimie 2012-2013 def elem(x): # print type(x),x # pour montrer que x est une chaîne de caractères element=Tk() element.title("Propriété du"+ x ) elembox=Listbox(element,height=32,width=40,fg="#070942") elembox.pack() for item in table[int(x)]: …
          • Représentation de moléculesplugin-autotooltip__default plugin-autotooltip_bigReprésentation de molécules

            Page à actualiser...

            Certaines fonctions de ce programme nécessite des fichiers de données : [base.csv] et [bdd.csv] #!/usr/bin/env python # -*- coding: UTF-8 -*- # travail de RL, ba2 chimie 2012-2013
          • Exemple d'utilisation de Counterplugin-autotooltip__default plugin-autotooltip_bigExemple d'utilisation de Counter

            Module collections :

            * *

            #!/usr/bin/env python # -*- coding: utf-8 -*- “”“ Recherche du nombre d'occurences des noms d'auteurs d'un article On copie dans all_authors les noms des auteurs
          • Suite de Fibonacci : quel est le meilleur algorithme ?plugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : quel est le meilleur algorithme ?

            Comparer les temps avec timeit

            La librairie timeit mesure les temps d'exécution en évitant des biais tels que l'usage concomitant d'autres ressources.

            #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : http://fr.wikipedia.org/wiki/Suite_de_Fibonacci Comparaison de différentes fonctions avec Timeit http://docs.python.org/2/library/timeit.html http://www.diveintopython.net…
          • Conversion de températuresplugin-autotooltip__default plugin-autotooltip_bigConversion de températures

            #!/usr/bin/env python # -*- coding: utf-8 -*- # Conversion de témpératures # programme réalisé par AC&JD, ba2 chimie 2010-2011

            from Tkinter import *

            def delwidgets():
          • Polynômes : la méthode de Hornerplugin-autotooltip__default plugin-autotooltip_bigPolynômes : la méthode de Horner

            432 Cela revient à effectuer les opérations successives suivantes :

            * prendre le coefficient de x4 * multiplier par x * ajouter le coefficient de x3 * multiplier par x * ajouter le coefficient de x2 *
          • Épidémie du coronavirus COVID-19plugin-autotooltip__default plugin-autotooltip_bigÉpidémie du coronavirus COVID-19

            Références :

            * Coronavirus disease 2019 * Maladie à coronavirus 2019 * Coronavirus COVID-19 Global Cases by Johns Hopkins CSSE * Coronavirus (COVID-19) Mortality Rate * data :

            Programmes de représentations

            FIXME

            Quelques simulations SEIR effectuées par des scientifiques :

            * Marius Gilbert (ULB/FNRS, Spatial Epidemiology lab (SpELL),
          • Jeu de la vie de Conwayplugin-autotooltip__default plugin-autotooltip_bigJeu de la vie de Conway

            Game of Life with Python

            #!/usr/bin/env python # -*- coding: utf-8 -*- “”“A minimal implementation of Conway's Game of Life.

            source : modified by par Jérémie Knoops, BA2 chimie UMONS, 2011-2012 cf.
          • RDKitplugin-autotooltip__default plugin-autotooltip_bigRDKit

            * * *
          • Algorithmes de rechercheplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes de recherche

            Classiquement, pour des données structurées en listes, arbres, un algorithme de recherche va selon un critère donné (une valeur par exemple) retourner un ensemble d'occurrences (toutes, plusieurs, une seule,...).

            Recherche séquentielle
          • Tableau périodiqueplugin-autotooltip__default plugin-autotooltip_bigTableau périodique

            #!/usr/bin/env python # -*- coding: utf-8 -*- # Programme sur le tableau périodique # MJ, Ba2 chimie 2010-2011

            from Tkinter import * from element_liste import * #sert à importer la liste présente dans l'autre fichier
          • Polynômes : évaluationplugin-autotooltip__default plugin-autotooltip_bigPolynômes : évaluation

            #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynômes """

            x = 3. # variable en laquelle on veut évaluer le polynôme a = [2.5, 6., 1.2, 3, 5] # la liste des coefficients, par ordre croissant n = len(a) - 1 # l'ordre du polynôme print(x,a,n) p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes

            print(p)
          • Polynômes : version alternative pour l'additionplugin-autotooltip__default plugin-autotooltip_bigPolynômes : version alternative pour l'addition

            Proposition de BF, étudiant ba2 2012-2013. Le principe est d'additionner les termes tant qu'on est en dessous du degré maximum du polynôme de degré minimum ! et en complétant ensuite par les coefficients de degré supérieur du polynôme de degré maximum
          • Suite de Fibonacciplugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci

            La suite de Fibonacci est une suite d'entiers dans laquelle chaque terme est la somme des deux termes qui le précèdent. Elle commence généralement par les termes 0 et 1 (parfois 1 et 1) et ses premiers termes sont : 0, 1, 1, 2, 3, 5, 8, 13, 21, etc. (reference
          • Ensemble de Mandelbrotplugin-autotooltip__default plugin-autotooltip_bigEnsemble de Mandelbrot

            Dessin d'une fractale : l'ensemble de Mandelbrot

            #!/usr/bin/env python # -*- coding: utf-8 -*- # version un peu aménagée du travail de BF, ba2 chimie 2012-2013 # ref :

            from Tkinter import * from random import randrange
          • Graphe simple de sinus et cosinusplugin-autotooltip__default plugin-autotooltip_bigGraphe simple de sinus et cosinus

            On montre en détail comment réaliser une représentation graphique simple des fonctions sinus et cosinus. Au départ le graphique utilisera les réglages par défaut et la figure sera ensuite améliorée pas à pas en commentant les instructions matplotlib utilisées.
          • Algorithmes sur entiersplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes sur entiers

            cf....... Cette page reprend quelques grands algorithmes classiques sur les nombres entiers, et introduit quelques algorithmes ayant des applications en chimie.

            Recherche du PGCD (plus grand commun diviseur)

            Explication géométrique : en comprenant un nombre entier comme une longueur et un couple d'entiers (a,b) comme un rectangle, leur PGCD est la longueur du côté du plus grand carré permettant de carreler entièrement ce rectangle. L'algorithme d'Euclide décompose ce re…
          • Polynômesplugin-autotooltip__default plugin-autotooltip_bigPolynômes

            Travail avec des polynômes :

            * un polynôme est une fonction * un polynôme est caractérisé de manière univoque par ses coefficients * le degré d'un polynôme est l'exposant qui caractérise le terme de puissance la plus élevée
          • Polynômes : boucle for, fonction mathématiqueplugin-autotooltip__default plugin-autotooltip_bigPolynômes : boucle for, fonction mathématique

            #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """ from math import *

            def polyeval(x,a): """ Fonction s'occupant uniquement de l'évaluation du polynome fonction de x avec les coefficients dans la liste a """ n = len(a)-1 p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes return p …
          • Exemple d'utilisation de namedtupleplugin-autotooltip__default plugin-autotooltip_bigExemple d'utilisation de namedtuple

            L'utilisation de namedtuple peut s'avérer plus rapide que la définition de classes (objets)

            #!/usr/bin/env python # -*- coding: utf-8 -*-

            from collections import namedtuple
          • Flocon de Kochplugin-autotooltip__default plugin-autotooltip_bigFlocon de Koch

            Courbe fractale créée suivant un principe de récursivité, en utilisant la librairie turtle

            #!/usr/bin/env python # -*- coding: iso-8859-1 -*-

            # exemple de courbe fractale (Koch) # cf. http://fr.wikipedia.org/wiki/Flocon_de_von_Koch # et http://en.wikipedia.org/wiki/Koch_snowflake # ce programme est basé sur un principe de récursivité # (une fonction qui s'appelle elle-même)

            from turtle import * # module turtle. Doc : http://docs.python.org/library/turtle.html from time impo…
          • Polynômes : graphes de fonctions polynomialesplugin-autotooltip__default plugin-autotooltip_bigPolynômes : graphes de fonctions polynomiales

            #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """ from math import * from pylab import * # librairies de graphiques (matplotlib)

            def polyeval(x,a): """ application de l'agorithme de Horner cf. http://fr.wikipedia.org/wiki/M%C3%A9thode_de_Ruffini-Horner """ n = len(a)-1 # n = ordre du polynome p = 0. for i in range(n,-1,-1): p = p*x + a[i] return p

            def…
          • Régression linéaireplugin-autotooltip__default plugin-autotooltip_bigRégression linéaire

            Entrée de couples, calcul et affichage de la droite de moindres carrés

            #!/usr/bin/env python # -*- coding: utf-8 -*- # version un peu aménagée du travail de BD et EH, ba2 chimie 2012-2013

            import matplotlib.pyplot as plt import pylab import numpy
          • Polynômes : fonction pour évaluerplugin-autotooltip__default plugin-autotooltip_bigPolynômes : fonction pour évaluer

            #!/usr/bin/python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """

            def polyeval(x,a): """ Fonction s'occupant uniquement de l'évaluation du polynome fonction de x avec les coefficients dans la liste a """ n = len(a) - 1 p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes return p

            # premier exemple d'utilisation …
          • Création d'une grille et de configurations d'un système binaire modéliséplugin-autotooltip__default plugin-autotooltip_bigCréation d'une grille et de configurations d'un système binaire modélisé

            #!/usr/bin/env python # -*- coding: utf-8 -*- # travail de ML et MP, ba2 chimie 2012-2013 # Création d'une grille et de configurations d'un système binaire modélisé
          • presentation_principesplugin-autotooltip__default plugin-autotooltip_big* Qu'est-ce qu'un langage de programmation ? * Compilation ou interprétation, ou... ?

            * Décrire des instructions dans un langage compréhensible par un être humain, mais transformable en d'autres instructions compréhensibles par l'ordinateur (langage machine)
          • Les bases de Plotlyplugin-autotooltip__default plugin-autotooltip_bigLes bases de Plotly

            Plotly ( est une société développant des outils analytiques et de visualisation. La librairie python Plotly permet de créer des graphes dans l'environnement de Jupyter. FIXME : à compléter

            Références

            * plot.ly, le site officiel
          • Pavage de Penroseplugin-autotooltip__default plugin-autotooltip_bigPavage de Penrose

            #!/usr/bin/env python # -*- coding: utf-8 -*- # réference : # version un peu aménagée du travail de EC et LP, ba2 chimie 2012-2013

            import math import cmath import cairo

            # definir le nombre d'or goldenRatio = (1 + math.sqrt(5)) / 2
          • Mathématiques et nombresplugin-autotooltip__default plugin-autotooltip_bigMathématiques et nombres

            Quelques programmes et algorithmes reliés aux mathématiques et aux nombres.

            * Théorie des nombres * Nombre_remarquable * ...

            Calculs en précision arbitraire

            * 1/9² = 0.0123456790123456790123456790123456790123456790123457... * 1/99² = 0.0001020304050607080910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455565758596061626364656667686970717273747576777879808182838485868788899091929394959697990001020304050607080910111$…
          • Décomposition de formules chimiquesplugin-autotooltip__default plugin-autotooltip_bigDécomposition de formules chimiques

            Analyse de chaînes de caractères formées par la concaténation de symboles d'éléments chimiques.

            Problème de base

            * Décomposer une chaîne de caractères formée par des symboles chimiques répétés : CaClCNOSbInAsFICl
          • pH et courbe de titrageplugin-autotooltip__default plugin-autotooltip_bigpH et courbe de titrage

            #!/usr/bin/env python # -*- coding: utf-8 -*- # Programme de calculs de pH et de courbes de titrages # AD & BW, Ba2 chimie 2010-2011

            from math import * from Tkinter import * import matplotlib.pyplot as plt import numpy as np
          • Entropie de mélange pour un gaz ou liquide idéalplugin-autotooltip__default plugin-autotooltip_bigEntropie de mélange pour un gaz ou liquide idéal

            #! /usr/bin/env python # -*- coding: utf-8 -*- “”“ représentation graphique de l'entropie de mélange d'un système idéal ”“”

            import numpy as np # voir
          • Polynômes : comment les multiplier par un scalaire et les additionnerplugin-autotooltip__default plugin-autotooltip_bigPolynômes : comment les multiplier par un scalaire et les additionner

            #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes + fonction de multiplication d'un polynôme pas un scalaire + fonction d'addition de deux polynômes """ from math import *

            def polyeval(x,a): """ application de l'agorithme de Horner cf. http://fr.wikipedia.org/wiki/M%C3%A9thode_de_Ruffini-Horner """ n = len(a) - 1 # n = ordre du polynôme p =0. for…
          • Optimisation de la température caractéristique du diamant suivant le modèle d'Einsteinplugin-autotooltip__default plugin-autotooltip_bigOptimisation de la température caractéristique du diamant suivant le modèle d'Einstein

            Ce modèle prévoie la dépendance à la température de la capacité calorifique d’un solide cristallin.

            La détermination de la température caractéristique nécessite de
          • Solubilité en fonction du pH et de la températureplugin-autotooltip__default plugin-autotooltip_bigSolubilité en fonction du pH et de la température

            Interface en ligne de commande et graphiques matplotlib

            Nécessite [ce fichier de données] (à décompresser).

            #!/usr/bin/env python # -*- coding: utf-8 -*- “”“
          • Traduction de l'ADN en séquence d'acides aminésplugin-autotooltip__default plugin-autotooltip_bigTraduction de l'ADN en séquence d'acides aminés

            #!/usr/bin/env python # -*- coding: iso-8859-1 -*-

            # python code to translante DNA sequences into proteins # traduction de l'ADN en séquence d'acides aminés (protéine)
          • Polynômes : graphe multiple fonctions polynomialesplugin-autotooltip__default plugin-autotooltip_bigPolynômes : graphe multiple fonctions polynomiales

            # -*- coding: utf-8 -*- """ graphe multiple de polynômes de Tchebyshev cf. http://fr.wikipedia.org/wiki/Polyn%C3%B4me_de_Tchebychev """

            from pylab import * # librairie graphique (Matplotlib)

            def polyeval(x,a): """ application de l'agorithme de Horner cf. http://fr.wikipedia.org/wiki/M%C3%A9thode_de_Ruffini-Horner """ n = len(a)-1 # n = ordre du polynôme p = 0. for i in range(n,-1,-1): p = p*x + a[i] …
          • L'attracteur de Lorenzplugin-autotooltip__default plugin-autotooltip_bigL'attracteur de Lorenz

            L'attracteur de Lorenz est un système d'équations différentielles ordinaires au comportement particulier, chaotique. C'est un exemple classique de nombreux cours scientifiques, et plusieurs sites proposent des solutions.

            Avec du code appliquant le méthode de Runge-Kutta d'ordre 4
          • Algorithmes de triplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes de tri

            Un algorithme de tri est, en informatique ou en mathématiques, un algorithme qui permet d'organiser une collection d'objets selon un ordre déterminé (Référence wikipedia).

            Les tris sont intéressants du point de vue de l'apprentissage de l'algorithmique.
          • Graphe d'une famille de polynômes orthogonauxplugin-autotooltip__default plugin-autotooltip_bigGraphe d'une famille de polynômes orthogonaux

            Voici un programme permettant de visualiser les premiers polynômes orthogonaux de Tchebyshev :

            #!/usr/bin/env python # -*- coding: utf-8 -*- """ graphes de Polynomes de Chebyschev """

            from math import * from pylab import *

            def polyeval(x,a): """ application de l'algorithme de Horner cf. http://fr.wikipedia.org/wiki/M%C3%A9thode_de_Ruffini-Horner """ n = len(a)-1 # n = ordre du polynome p = 0. for i in range(n,-1,-1): …
          • OpenBabel et Jmolplugin-autotooltip__default plugin-autotooltip_bigOpenBabel et Jmol

            OpenBabel

            OpenBabel est un ensemble de programme permettant de manipuler et convertir les fichiers de description de molécules dans différents formats.

            * Site officiel : * Interfaçage en Python :

            Pour utiliser OpenBabel en python, il faut installer au préalable ces outils. Sous Linux (Debian, Ubuntu,
          • Factorielle : une fonction en Pythonplugin-autotooltip__default plugin-autotooltip_bigFactorielle : une fonction en Python

            Voici une version avec la fonction factorielle()

            #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calcul de la factorielle d'un nombre Référence : http://fr.wikipedia.org/wiki/Factorielle """ def factorielle(arg_n): """ structure de répétition pour appliquer la définition de la factorielle """ reponse = 1 # la réponse sera dans la variable reponse i = 1 # on va commencer par 1 while i <= arg_n: …
          • Polynômes : fonctionnalités supplémentairesplugin-autotooltip__default plugin-autotooltip_bigPolynômes : fonctionnalités supplémentaires

            Voici quelques fonctions utiles pour manipuler les polynômes :

            Dérivation

            Proposé et testé par RL, étudiant ba2 2012-2013.

            #!/usr/bin/env python # -*- coding: utf-8 -*- def polyderiv(a): """ dérivation d'un polynôme """ b = a[:] #copie de la liste des coefficients du polynôme de départ n = len(b) -1 #ordre du polynôme for i in range (n+1): b[i] = b[i] * i #on redéfinit chaque coefficient i de la liste par ce…
          • Trucs et astucesplugin-autotooltip__default plugin-autotooltip_bigTrucs et astuces

            * Fusionner deux dictionnaires * * ...
          • Glossaire de chimieplugin-autotooltip__default plugin-autotooltip_bigGlossaire de chimie

            Cf. le glossaire de chimie

            #!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Utilisation du glossaire https://dvillers.umons.ac.be/wiki/teaching:glossaire-chimie Le code dokuwiki source doit être sauvegardé dans un fichier glossaire-dokuwiki.txt

            Programme de base à modifier/compléter. """ from pathlib import Path home = str(Path.home())

            # fichier d'entrée with open(home + "/tempo/glossaire-dokuwiki.txt", "r") as ifile: lines = ifile.readlines() ifile.close() …
          • Test de Studentplugin-autotooltip__default plugin-autotooltip_bigTest de Student

            Le test de Student (t-test) teste statistiquement l’hypothèse d’égalité de l'espérance de deux variables aléatoires suivant une loi normale et de variance inconnue.

            Références

            * (des exemples simples) * Documentation Python sur stats de scipy * 1-sample t-test * Unpaired t-test * Paired t-test
          • Impressions avec la méthode .print()plugin-autotooltip__default plugin-autotooltip_bigImpressions avec la méthode .print()

            FIXME : à compléter par les règles essentielles et quelques exemples

            Références

            * * * *
          • Codes de la présentationplugin-autotooltip__default plugin-autotooltip_bigCodes de la présentation

            Turtle

            Cf. la documentation officielle.

            #!/usr/bin/python # -*- coding: UTF-8 -*-

            # exemple de base turtle # from turtle import * import sys import time

            reset() x=-100 y=-100 i=0 while i < 10: j=0 while j <10: up() goto(x+i*20,y+j*20) down() fill(1) n while <4 : forward(16) left(90) color([i*0.1,j*0.1,0]) fill(0) color(0,0,0) j =j…
          • Scikit-learnplugin-autotooltip__default plugin-autotooltip_bigScikit-learn

            * *

            FIXME : ajouter des exemples avec analyse de textes contenant des termes scientifiques, des noms de substances chimiques,...

            * Scikit-chem, simple cheminformatics for Python * MolMiner, for extracting compounds from scientific literature *
          • Courbe de Prédominance d'un Acideplugin-autotooltip__default plugin-autotooltip_bigCourbe de Prédominance d'un Acide

            #!/usr/bin/env python # -*- coding: utf-8 -*- # travail de KH, ba2 chimie 2012-2013

            # Courbe de Prédominance d'un Acide # from math import * import matplotlib.pyplot as plt from Tkinter import *
          • Les bases de NumPyplugin-autotooltip__default plugin-autotooltip_bigLes bases de NumPy

            NumPy est une extension du langage de programmation Python, destinée à manipuler des matrices ou tableaux multidimensionnels ainsi que des fonctions mathématiques opérant sur ces tableaux.

            Numpy permet la manipulations des vecteurs, matrices et polynômes.
          • Jupyter, IPython Notebooks et JupyterLabplugin-autotooltip__default plugin-autotooltip_bigJupyter, IPython Notebooks et JupyterLab

            * Jupyter a succédé à IPython Notebook * Jupyter est installé par défaut avec la distribution python Anaconda. C'est la manière la plus adéquate d'utiliser Jupyter. * Sinon, on peut utiliser facilement les notebooks Jupyter sur la plateforme
          • Analyse d'imagesplugin-autotooltip__default plugin-autotooltip_bigAnalyse d'images

            Le traitement d'images permet de transformer des images. L'analyse d'images permet d'extraire des informations contenues dans une image. Il est aussi possible d'effectuer des tâches plus complexes de reconnaissance et d'analyse de scènes.
          • Bioinformatiqueplugin-autotooltip__default plugin-autotooltip_bigBioinformatique

            Manipulations de séquences ADN, ARN, protéines,...

            Compter les nucléotides d'une séquence ADN

            #!/usr/bin/env python # -*- coding: utf-8 -*- """ On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T') Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases """ adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

            # utilisation d'une liste et de la méthode .count() base…
          • Suite de Fibonacci : encore un algorithmeplugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : encore un algorithme

            Voici le programme complété pour la technique récursive :

            #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : http://fr.wikipedia.org/wiki/Suite_de_Fibonacci Application de la définition par récursivité. """ def fibonacci_item_recursive(n): """ Renvoie l'élément d'indice n de la suite de Fibonacci """ if n == 0: return 0 elif n == 1: return 1 ret…
          • Les bases de Pygalplugin-autotooltip__default plugin-autotooltip_bigLes bases de Pygal

            FIXME

            Références

            * * Why use pygal?
          • Jeux de Nimplugin-autotooltip__default plugin-autotooltip_bigJeux de Nim

            * fr:Jeux_de_Nim * Nim: A Game Playing Program Seymour Papert, MIT Artificial Intelligence Memo No. 254, 1970 (from The Collected Writings of Seymour Papert) * version de l'article sur archive.org, version texte disponible

            FIXME : codes python...

            Références

            * évolution du jeu, javascript en ligne * vidéo sur l'élaboration d'un programme en python
          • Slices sur les séquencesplugin-autotooltip__default plugin-autotooltip_bigSlices sur les séquences

            L'utilisation des “slices” ou du “slicing” sur les listes, ou sur tout objet en séquence (tuple, chaîne de caractères, ...) permet de “découper” des sous-listes. Si la séquence s'appelle sequence_name, la syntaxe du slice est : sequence_name[start:stop:step] où start est l'indice du premier élément (par défaut 0), stop est l'indice du premier élément NON REPRIS (par défaut len(seq
          • Les bases de SciPyplugin-autotooltip__default plugin-autotooltip_bigLes bases de SciPy

            La librairie SciPy ajoute à NumPy des fonctionnalités mathématiques.

            Directive d'importation

            * Méthode standard : import scipy as sp

            * Importation par sous-modules (cf le site de Scipy) : from scipy import optimize from scipy import interpolate from scipy import integrate ...
          • Programmation Python Orientée Objetplugin-autotooltip__default plugin-autotooltip_bigProgrammation Python Orientée Objet

            FIXME : en construction

            Concepts utilisés

            * Un objet : c'est... n'importe quoi, qui peut être codé. En Python, tout est objet ! * Une classe est une description générique d'un type d'objet, incluant les données et les méthodes qui le caractérisent
          • Les bases de Matplotlib, une librairie pour réaliser des graphiques 2Dplugin-autotooltip__default plugin-autotooltip_bigLes bases de Matplotlib, une librairie pour réaliser des graphiques 2D

            Matplotlib est une bibliothèque très puissante du langage de programmation Python destinée à tracer et visualiser des données sous formes de graphiques. Elle est souvent combinée avec les bibliothèques python de calcul scientifique :
          • les bases de Altair, une librairie graphique interactiveplugin-autotooltip__default plugin-autotooltip_bigles bases de Altair, une librairie graphique interactive

            * Altair: Declarative Visualization in Python — Altair 4.1.0 documentation * altair · PyPI * (Tutorial) Altair in Python: Data Visualizations - DataCamp * Python Interactive Data Visualization with Altair - Towards Data Science * Stackoverflow * python - Altair not rendering chart in jupyter notebook - Stack Overflow * python - Not able to display altair charts in jupyter notebook - Stack Overflow
          • Notions avancéesplugin-autotooltip__default plugin-autotooltip_bigNotions avancées

            En construction. Les liens sont juste donnés. Une introduction et un exemple devrait être proposé pour chaque rubrique, et le nombre de ces rubriques augmenté.

            Itérateurs

            Générateurs et "yield"

            * * * *
          • Suite de Fibonacci : un premier programmeplugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : un premier programme

            Voici un embryon non fonctionnel de programme. Il y manque alors des éléments (à la place des “???”)

            #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : http://fr.wikipedia.org/wiki/Suite_de_Fibonacci """ # élément d'indice 0 i = 0 a = 0 print(i,a) # élément d'indice 1 i = 1 b = 1 print(i,b)

            # structure de répétition pour appliquer la règle de récurrence max = 100 # indice du dernier …
          • Test Javascript + dokuwiki + DataCamp-lightplugin-autotooltip__default plugin-autotooltip_bigTest Javascript + dokuwiki + DataCamp-light

          • Algorithmes de graphesplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes de graphes

            Références diverses

            * * * * * * (depuis Python 3.9)
          • Calul matricielplugin-autotooltip__default plugin-autotooltip_bigCalul matriciel

            #!/usr/bin/env python # -*- coding: UTF-8 -*- # (pdf) # #pour operation matriciel verification mathématique : # #
          • Factorielle : travaux additionnelsplugin-autotooltip__default plugin-autotooltip_bigFactorielle : travaux additionnels

            Idées d'exercices complémentaires, d'applications.

            Utilisation d'un dictionnaire

            Il peut être intéressant de précalculer des factorielles qui seront mémorisées dans un dictionnaire.

            Comparaison avec l'approximation de Stirling
          • Bases de données libres en chimieplugin-autotooltip__default plugin-autotooltip_bigBases de données libres en chimie

            Références

            Databases, databank

            * Chemical databases +... * * * * *

            Données de wikipedia

            * Chembox template * * *
          • Interrogation de la base de données géolocalisées OpenStreetMapplugin-autotooltip__default plugin-autotooltip_bigInterrogation de la base de données géolocalisées OpenStreetMap

            API OSM en Python

            * Application Programming Interface, en Python

            Installation via pip :

            pip(3) install osmapi

            Exemple de code

            Recherche de débit de boissons (“pub”) via la base de données d'OpenStreetMap.

            #!/usr/bin/python # -*- coding: UTF-8 -*-
          • Vue 3D de l'électronégativitéplugin-autotooltip__default plugin-autotooltip_bigVue 3D de l'électronégativité

            #!/usr/bin/env python # -*- coding: utf-8 -*- """ Periodical table 3D view of electronegativity """

            from mpl_toolkits.mplot3d import Axes3D import matplotlib.pyplot as plt import numpy as np

            data = np.array([ [2.2,1,0.9,0.8,0.8,0.8,0.7], [0,1.6,1.3,1,1,0.9,0.9], [0,0,0,1.4,1.2,1.3,0], [0,0,0,1.5,1.3,1.3,0], [0,0,0,1.6,1.6,1.5,0], [0,0,0,1.6,2.2,2.4,0], [0,0,0,1.6,1.9,1.9,0], [0,0,0,1.8,2.2,2.2,0], [0,0,0,1.9,2.3,2.2,0], [0,0,0,1.8,2.2,2.3,0], [0,0,0,1.9,1.9,2.5…
          • Représentation 3D du pHplugin-autotooltip__default plugin-autotooltip_bigReprésentation 3D du pH

            Cas d'un acide en fonction d'un ajout de base et d'une dilution globale : cf. cet article

            #! /usr/bin/env python # -*- coding: utf-8 -*- “”“ Use of numpy polynomes to compute pH of weak acid and strong base
          • Polynômes : structure de répétition (boucle for)plugin-autotooltip__default plugin-autotooltip_bigPolynômes : structure de répétition (boucle for)

            #!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """

            def polyeval(x,a): """ Fonction s'occupant uniquement de l'évaluation du polynome fonction de x avec les coefficients dans la liste a """ n = len(a) - 1 p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes return p

            varx = 0.5 varc…
          • Factorielle : un premier programmeplugin-autotooltip__default plugin-autotooltip_bigFactorielle : un premier programme

            Voici un embryon non fonctionnel de programme. Il y manque des éléments (à la place des “???”)

            #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calcul de la factorielle d'un nombre Référence : http://fr.wikipedia.org/wiki/Factorielle """ # on demande le nombre : print("Calcul de la factorielle de n") chainelue = input("Que vaut n ? ") n = int(chainelue) print(n)

            # structure de répétition pour appliquer la définition de la factorielle reponse=1 # la répon…
          • Calcul de factoriellesplugin-autotooltip__default plugin-autotooltip_bigCalcul de factorielles

            La factorielle d'un nombre naturel n est le produit des nombres entiers strictement positifs inférieurs ou égaux à n. Elle est notée n!. Pour n=0, on a 0!=1, ensuite 1!=1, 2!=2, 3!=6, 4!=24,...

            Un premier (mauvais) programme

            Regardez, et essayez
          • Graphiques des pressions partielles de systèmes non-idéauxplugin-autotooltip__default plugin-autotooltip_bigGraphiques des pressions partielles de systèmes non-idéaux

            #!/usr/bin/env python # -*- coding: utf-8 -*- “”“ Graphiques des pressions partielles de systèmes non-idéaux Basé sur le travail de ML et VM, ba2 chimie 2013-2014
          • Marche aléatoire 2D simpleplugin-autotooltip__default plugin-autotooltip_bigMarche aléatoire 2D simple

            Dans les modèles les plus simples, on considère un polymère comme un ensemble de segments faisant entre eux un angle quelconque (freely jointed chain). Ce problème est aussi dénommé “marche aléatoire” (random walk) en mathématique ou physique. Il peut aussi rendre compte d'autres phénomènes tel que celui de la diffusion. Après simulation, vous comprendrez pourquoi on appelle
          • Pandasplugin-autotooltip__default plugin-autotooltip_bigPandas

            Module pour l'analyse de données, pouvant se substituer à l'utilisation d'un tableur. Une différence fondamentale de la librairie pandas avec NumPy, c'est que les tableaux NumPy (NumPy arrays) ont le même type (dtype) pour le tableau entier, tandis que les tableaux pandas (pandas DataFrames) sont caractérisés par un type unique (dtype) par colonne.$X$$x$$P(x)$$X$$x$$x_1, x_2, x_3, \ldots$$X$$P(x_i)$$X$$x$$P(x)$$x$$x+dx$$P(x)$$x$$P(x) dx$$P(x) dx = P(x \le X < x+dx)$$P(x_i) \ge 0$$x_i$$P(…
          • Utilisation de polynômes orthogonaux avec NumPyplugin-autotooltip__default plugin-autotooltip_bigUtilisation de polynômes orthogonaux avec NumPy

            Voici un programme permettant d'obtenir le même graphe que celui obtenu précédemment, en utilisant les modules spécifiques de NumPy. Cet exemple montre tout l'intérêt d'utiliser des modules pré-existants. Le programme est réduit à 3 lignes pour l'importation, 4 pour la création des graphes et 4 pour commander la représentation.
          • Modélisation de la diffusion chimique dans un filmplugin-autotooltip__default plugin-autotooltip_bigModélisation de la diffusion chimique dans un film

            Technique de différences finies, utilisation de matplotlib

            #!/usr/bin/env python # -*- coding: utf-8 -*- from math import * # pour utiliser la librairie graphique matplotlib from pylab import *
          • Fizz buzzplugin-autotooltip__default plugin-autotooltip_bigFizz buzz

            Fizz buzz est un jeu de comptage et de divisibilité conçu pour des enfants. Les joueurs comptent à tour de rôle en incrémentant, partant de 1, et remplaçant chaque nombre divisible par 3 par le mot “fizz”, et chaque mot divisible par 5 par le mot
          • Loi des gaz parfaitsplugin-autotooltip__default plugin-autotooltip_bigLoi des gaz parfaits

            #!/usr/bin/env python # -*- coding: utf-8 -*- # Programme de calculs sur la loi des gaz parfaits # GD, Ba2 chimie 2010-2011 from Tkinter import * #permet l'apparition de l'interface graphique
          • Éléments et moléculesplugin-autotooltip__default plugin-autotooltip_bigÉléments et molécules

            Les propriétés des éléments chimiques, de molécules peuvent être dressées, listées,... par un programme si on dispose des données. Christoph Gohlke (University of California, Irvine), a écrit une librairie molmass pour accéder aux propriétés des éléments, et calculer les masses moléculaires, compositions élémentaires, spectres de distribution des masses de molécules,
          • Pièges à éviterplugin-autotooltip__default plugin-autotooltip_bigPièges à éviter

            Quelques pièges à éviter !

            Type de données

            * travailler avec des nombres et ne pas mettre le point décimal s'ils ont une valeur entière les laissera dans le type 'int'. * Ne pas confondre une liste contenant un nombre, et ce nombre.
          • Manipulations de matricesplugin-autotooltip__default plugin-autotooltip_bigManipulations de matrices

            Les matrices sont des tableaux de nombres à deux dimensions. On peut utiliser des listes de lignes, qui sont elles-mêmes des listes d'éléments de la ligne, pour représenter une matrice. On aura donc des listes de listes.
          • Représentation de pH d'acides et de basesplugin-autotooltip__default plugin-autotooltip_bigReprésentation de pH d'acides et de bases

            Pour les acides :

            #!/usr/bin/env python # -*- coding: utf-8 -*- # travail de QD et TB, ba2 chimie 2012-2013

            import Tkinter as tk from numpy import * import matplotlib.pyplot as plt
          • Traduction ADN-ARN-protéineplugin-autotooltip__default plugin-autotooltip_bigTraduction ADN-ARN-protéine

            Avec l'interface Tk. Voir aussi le programme Traduction de l'ADN en séquence d'acides aminés (protéine) : utilisation d'un dictionnaire (type Python)

            #!/usr/bin/env python # -*- coding: utf-8 -*- “”“ Traduction de codes ADN en ARN et protéine. Basé sur le travail de NR et CVDD, ba2 chimie 2013-2014
          • Notions fondamentalesplugin-autotooltip__default plugin-autotooltip_bigNotions fondamentales

            Aide mémoire synthétique sur le langage Python. Les différences importantes entre la branche 2 et la branche 3 seront commentées. La différence la plus fréquente est le passage de print à print() !

            Règles de base

            Ces règles peuvent être testées via le mode interactif de Python (en utilisant la fenêtre
          • Suite de Fibonacci : écriture de fonctionsplugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : écriture de fonctions

            Voici la structure que doit avoir un programme pour lequel le calcul de l'élément d'indice n de la suite de Fibonacci est encapsulé dans une fonction :

            #! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : http://fr.wikipedia.org/wiki/Suite_de_Fibonacci """ def fibonacci_item(n): """ Renvoie l'élément d'indice n de la suite de Fibonacci """ ...

            if __name__ == '__main__'…
          • Les bases d'un interface graphique avec Tkinterplugin-autotooltip__default plugin-autotooltip_bigLes bases d'un interface graphique avec Tkinter

            Quelques références de base pour utiliser Tkinter

            * Documentation officielle : * Les interfaces graphiques TK * tkinter — interface Python à Tcl/Tk, reprenant quelques références recommandées * Python 3 avec Tk intègre également les extensions
          • matplotlib_gallery
            • Potentiel de Morseplugin-autotooltip__default plugin-autotooltip_bigPotentiel de Morse

              Potentiel de Morse et approximation harmonique, avec représentation des niveaux d'énergie des modèles quantiques correspondants.

              Code source :

              #! /usr/bin/env python # -*- coding: utf-8 -*- """ Représentation du potentiel de Morse pour H2 http://en.wikipedia.org/wiki/Morse_potential http://en.wikipedia.org/wiki/Quantum_harmonic_oscillator approximation harmonique D_e = 7.6E-19 J a = 19.3E-15 m r_e= 74.1E-12 m dérivée de seconde d2V/dr2 = 2 * D_e * a**2. """ import matplot…
            • Histogramme simpleplugin-autotooltip__default plugin-autotooltip_bigHistogramme simple

              #! /usr/bin/env python # -*- coding: utf-8 -*- “”“ Matplotib : histogramme simple de nombres aléatoires ”“” from pylab import randn, hist, show #importation simplifiée
            • Couples acide-base dans le plan pKa/pKbplugin-autotooltip__default plugin-autotooltip_bigCouples acide-base dans le plan pKa/pKb

              * Conventions sur les acides forts et les bases fortes : cf. Les acides, les bases et les sels qui nous entourent - Acide fort, base forte

              #!/usr/bin/env python3 # -*- coding: utf-8 -*-

              """ Library references : *

              """ import matplotlib.pyplot as plt # directive d'importation standard de Matplotlib import numpy as np # directive d'importation standard de numpy

              def cm2inch(*tupl): # https://stackoverflow.com/questions/14708695/sp…
            • Rotateur biatomiqueplugin-autotooltip__default plugin-autotooltip_bigRotateur biatomique

              Cf. cette page.

              Code source, en Python 3 :

              #!/usr/bin/env python # -*- coding: utf-8 -*- """ Somme d'état (ensemble canonique) de rotation (rotateur biatomique)

              Les impressions sont à récrire avec l'instruction format() de python 3 """

              from math import exp # on a juste besoin de l'exponentielle import matplotlib.pyplot as plt # directive d'importation standard de Matplotlib

              T = 100. # (température réduite = T / Theta) Zrot = 0. # somme d'état Jmax = 30 # valeur …
            • Surface d'énergie potentielleplugin-autotooltip__default plugin-autotooltip_bigSurface d'énergie potentielle

              Historique

              Eyring et Polanyi ont publié en 1931 l'article On Simple Gas Reactions dans lequel ils décrivent les trajets des atomes dans la réaction + H --> H + (échange d'atomes). Ces travaux aboutiront au développement des notions de $E_{bond}= D_e [\exp(-2\beta(r-r_e))-2\exp(-\beta(r-r_e))]$$E_{ant}= \frac{D_e}{2} [\exp(-2\beta(r-r_e))+2\exp(-\beta(r-r_e))]$$r_e$$D_e$$\beta$$E_{bond}= \frac{Q_{AB}+\alpha_{AB}}{1+S^2_{AB}} = \frac{Q_{AB}+\alpha_{AB}}{1+k}$$E_{a…
            • Spectre IR du COplugin-autotooltip__default plugin-autotooltip_bigSpectre IR du CO

              Différentes techniques de spectroscopie utilisent des représentations standardisées des spectres. En spectroscopie Infrarouge, l'absorbance est traditionnellement représentée en fonction des nombres d'ondes décroissants exprimés en $cm^{-1}$. Pour rappel, en spectroscopie, le $\tilde{\nu}$$\tilde{\nu} = 1/\lambda = \nu/c$$\Delta J = \pm 1$$cm^{-1}$
          • Représentation de la distribution de vitesse de Maxwell-Boltzmannplugin-autotooltip__default plugin-autotooltip_bigReprésentation de la distribution de vitesse de Maxwell-Boltzmann

            Pour la théorie, cf. le cours de physico-chimie ou la page Wikipédia sur la distribution de vitesse de Maxwell-Boltzmann

            Sans NumPy

            #! /usr/bin/env python # -*- coding: utf-8 -*- “”“ NumPy/Matplotib : representation de la distribution de vitesses de Maxwell-Boltzmann version SANS utilisation de NumPy cf cours et
          • Les bases de Bokeh, une librairie pour des visualisations interactives dans un navigateur webplugin-autotooltip__default plugin-autotooltip_bigLes bases de Bokeh, une librairie pour des visualisations interactives dans un navigateur web

            * page d'entrée sur Bokeh * User guide * Galerie d'exemples * Bokeh dans les Jupyter notebooks * Bokeh tutorial in live Jupyter Notebooks * Reference guide

            * Réseaux sociaux : * Twitter * GitHub * Youtube

            Exemples scientifiques

            * Interactions sur la fonction sinus (amplitude, décalage vertical, fréquence, déphasage) +
        • Approche scientifique de l'enseignement de la chimieplugin-autotooltip__default plugin-autotooltip_bigApproche scientifique de l'enseignement de la chimie

          Résumés de A.V.V, 2009-2010 (articles d'intérêt didactique) :

          * A.H. Johnstone, Chemistry Teaching – Science or Alchemy 1996 Brasted Lecture, Journal of Chemical Education, 1997, 74, 262-268. DOI: 10.1021/ed074p262 * N. Reid,
        • Comprendre la relation entre les concepts d’Arrhénius, de Bronsted-Lowry et de Lewisplugin-autotooltip__default plugin-autotooltip_bigComprendre la relation entre les concepts d’Arrhénius, de Bronsted-Lowry et de Lewis

          Article Understanding the Relationship Among Arrhenius, Brønsted–Lowry, and Lewis Theories Seoung-Hey Paik, J. Chem. Educ., 2015, 92 (9), pp 1484–1489 DOI: 10.1021/ed500891w résumé de S.G. 2015-2016

          Introduction

          Il existe de nombreux problèmes dans l’apprentissage par les élèves des concepts d’acide et de base. Ceux – ci sont notamment causés par la description utilisée par les manuels scolaires. En effet, …
        • micro-enseignementplugin-autotooltip__default plugin-autotooltip_bigPage déplacée ici :
        • Zincplugin-autotooltip__default plugin-autotooltip_bigZinc

          * fr:Zinc * Zinc

          * Anodes perdues * Galvanisation * Utilisations médicales de l'oxyde de zinc qui a des propriétés cicatrisantes et anti-inflammatoires. Il est un des composants des crèmes, ou ajouté au talc

          * voir aussi : * Calamine
        • Opéra et poison : une approche secrète et agréable pour enseigner et apprendre la chimieplugin-autotooltip__default plugin-autotooltip_bigOpéra et poison : une approche secrète et agréable pour enseigner et apprendre la chimie

          Opera and Poison: A Secret and Enjoyable Approach To Teaching and Learning Chemistry, João Paulo André, J. Chem. Educ., 2013, 90 (3), pp 352–357 DOI: 10.1021/ed300445b Résumé de D.D., 2014-2015

          Article d'intérêt dans le domaine pharmaceutique
        • Pourquoi les sels tels que le NaCl se dissolvent dans l'eau ?plugin-autotooltip__default plugin-autotooltip_bigPourquoi les sels tels que le NaCl se dissolvent dans l'eau ?

          * Cf. chemistry.stackexchange : Why do salts such as NaCl dissolve? * Question gérée par L.G. 2019-2020

          Contexte

          Début du cours sur la solvatation, 3ème degré du secondaire en sciences générales.

          Deux paramètres à prendre en compte :
        • Les solutions aqueuses d'anions amphiprotiques sont elles acides, basiques, ou neutres ?plugin-autotooltip__default plugin-autotooltip_bigLes solutions aqueuses d'anions amphiprotiques sont elles acides, basiques, ou neutres ?

          Article : Are Aqueous Solutions of Amphiprotic Anions Acidic, Basic, or Neutral? A Demonstration with Common pH Indicators Jervee M. Punzalan and Voltaire G. Organo, J. Chem. Educ., 2017, 94 (7), pp 911–915 DOI: 10.1021/acs.jchemed.6b00711 résumé de V.L. 2017-2018
        • Utilisation de la théorie de réponses aux items (IRT) pour évaluer les changements de performance des étudiants basés sur les changements dans la formulation des questionsplugin-autotooltip__default plugin-autotooltip_bigUtilisation de la théorie de réponses aux items (IRT) pour évaluer les changements de performance des étudiants basés sur les changements dans la formulation des questions

          Using Item Response Theory To Assess Changes in Student Performance Based on Changes in Question Wording, Kimberly D. Schurmeier, Charles H. Atwood, Carrie G. Shepler, Gary J. Lautenschlager Journal of Chemical Education, vol 87(11) 2010 pp 1268–1272 (Article) DOI: 10.1021/ed100422c - Résumé de S.S., 2010-2011.
        • Hydrogèneplugin-autotooltip__default plugin-autotooltip_bigHydrogène

          FIXME

          * Utilisation du dihydrogène * pile à combustible * électrolyse * Stockage de l'hydrogène, par compression (jusque 700 bar), liquéfaction (T < 20 kelvin), formation d'hydrures métalliques,... * utilisation comme gaz courant transporté dans des conduites
        • Comment équilibrer des réactions redox complexesplugin-autotooltip__default plugin-autotooltip_bigComment équilibrer des réactions redox complexes

          * Sources : * Chemistry Stackexchange : How to balance more complex redox reactions? * contribution de A.-C. N., étudiante AESS 2018-2019

          Équation redox compliquée non équilibrée:

          (s)+(aq) → (aq)+(g)+

          Procédure à suivre:
        • Chimie – Sciences générales – UAA 4 – Deuxième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 4 – Deuxième degré

          Identifier une espèce chimique par une réaction chimique

          Compétences à développer

          * Identifier expérimentalement l’oxygène, l’hydrogène, le dioxyde de carbone, des ions à l’aide de réactions de précipitation.
        • Mon acide peut battre ton acideplugin-autotooltip__default plugin-autotooltip_bigMon acide peut battre ton acide

          My Acid Can Beat Up Your Acid! Alice Putti J. Chem. Educ., 2011, 88 (9), pp 1278–1280 DOI: 10.1021/ed100849b résumé de A-P.C., 2010-2011

          Il s'agit d'une activité à réaliser en classe avec les élèves. Celle-ci leur permet d'étudier la différence entre les acides forts et les acides faibles. En effet, grâce aux formules de calcul de pH, la plupart des élèves savent qu'une solution d'acide fort 0,1M aura un pH d'environ 1 alors qu'une solution d'acide faible de m…
        • Changement climatique : une démonstration didactiqueplugin-autotooltip__default plugin-autotooltip_bigChangement climatique : une démonstration didactique

          Climate Change: A Demonstration with a Teaching Moment Steven Murov, J. Chem. Educ., 2013, 90 (11), pp 1486–1487 DOI: 10.1021/ed400363u résumé de S.P. 2014-2015

          * Objectif de l'article : Expérience visant à démontrer que le dioxyde de carbone n'est pas un composant majeur de l'atmosphère
        • Apprentissages actif et coopératif dans les cours de chimie organiqueplugin-autotooltip__default plugin-autotooltip_bigApprentissages actif et coopératif dans les cours de chimie organique

          Active Learning and Cooperative Learning in the Organic Chemistry Lecture Class, Donald R. Paulson, J. Chem. Educ., 1999, 76 (8), p 1136. Résumé de A.B., 2011-2012. Article d'intérêt didactique

          Introduction

          Dans nos universités, bons nombres de cours se présentent sous la forme d'exposés ex-cathedra, de lecture(s), de présentation powerpoint. Cette pratique n'est pas nouvelle, toutefois, nous pourrions nous poser la questio…
        • Arsenicplugin-autotooltip__default plugin-autotooltip_bigArsenic

          FIXME

          * fr:Arsenic & Arsenic

          L'arsenic a été fortement utilisé sous forme de sels comme pesticide en agriculture (Arséniate de plomb. En 1919, rien que la production mondiale d'arsenic était d'environ 20 000 tonnes ! (Source : Minerals Yearbook 1920, p60)
        • Poursuite chimique: un jeu de société Trivial modifiéplugin-autotooltip__default plugin-autotooltip_bigPoursuite chimique: un jeu de société Trivial modifié

          Article: Chemical Pursuit: A Modified Trivia Board Game Blakely M. Adair and Lyle V. McAfee, J. Chem. Educ., 2018, 95 (3), pp 416–418 DOI: 10.1021/acs.jchemed.6b00946 résumé de A.R. 2017-2018 + supporting info (fichiers du jeu)

          Introduction
        • Une démonstration colorée pour visualiser et investiguer les concepts essentiels de l'équilibre chimiqueplugin-autotooltip__default plugin-autotooltip_bigUne démonstration colorée pour visualiser et investiguer les concepts essentiels de l'équilibre chimique

          Article A Colorful Demonstration to Visualize and Inquire into Essential Elements of Chemical Equilibrium, Ingo Eilks and Ozcan Gulacar, J. Chem. Educ., 2016, 93 (11), pp 1904–1907 DOI: 10.1021/acs.jchemed.6b00252 résumé de M.H. 2016-2017. Lien
        • Démonstration des principes de spectrophotométrie en construisant un spectrophotomètre se basant sur le capteur de luminosité d’un smartphoneplugin-autotooltip__default plugin-autotooltip_bigDémonstration des principes de spectrophotométrie en construisant un spectrophotomètre se basant sur le capteur de luminosité d’un smartphone

          Article : Demonstrating Principles of Spectrophotometry by Constructing a Simple, Low-Cost, Functional Spectrophotometer Utilizing the Light Sensor on a Smartphone Bill S. Hosker, J. Chem. Educ., 2018, 95 (1), pp 178–181 DOI: 10.1021/acs.jchemed.7b00548 résumé de J.P. 2018-2019
        • Pourquoi la phénolphtaléine est un indicateur approprié pour le titrage d'un acide fort par une base forte ?plugin-autotooltip__default plugin-autotooltip_bigPourquoi la phénolphtaléine est un indicateur approprié pour le titrage d'un acide fort par une base forte ?

          * Sources : * Chemistry Stackexchange : Why is phenolphthalein an appropriate indicator for titration of a strong acid with a strong base ? * contribution de E.F., étudiant AESS 2018-2019

          La phénolphtaléine est incolore en dessous d'un pH de 8,2 et devient couleur
        • Découvrir les éléments chimiques dans la nourritureplugin-autotooltip__default plugin-autotooltip_bigDécouvrir les éléments chimiques dans la nourriture

          Article Discovering the Chemical Elements in Food Antonio Joaquín Franco-Mariscal J. Chem. Educ., 2018, 95 (3), pp 403–409 DOI: 10.1021/acs.jchemed.7b00218 résumé de M.R. 2018-2019

          But de l'article

          Étudier les possibilités d’enseignement des éléments chimiques en combinant 4 stratégies: l’usage d’un contexte, l’apprentissage basé sur l’investigation, l’usage d’affiches et l’usage des QR codes. Projet : fait avec 26 élèves de 15 ans…
        • Chimie – Sciences générales – UAA 3 – Deuxième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 3 – Deuxième degré

          La réaction chimique : approche quantitative

          Compétences à développer

          * Déterminer expérimentalement les coefficients stœchiométriques d’une réaction complète. * Résoudre des problèmes de stœchiométrie dans le cas de réactions complètes.
        • Jouer avec le feu: expertise requise en matière de sécurité chimiqueplugin-autotooltip__default plugin-autotooltip_bigJouer avec le feu: expertise requise en matière de sécurité chimique

          Article Playing with Fire: Chemical Safety Expertise Required Samuella B. Sigmann, J. Chem. Educ., 2018, 95 (10), pp 1736–1746 DOI: 10.1021/acs.jchemed.8b00152 résumé de M.R. 2018-2019

          Au cours des 20 dernières années, 164 enfants et éducateurs auraient été blessés lors de laboratoire utilisant des solvants inflammables.
        • Azoteplugin-autotooltip__default plugin-autotooltip_bigAzote

          FIXME

          Agriculture :

          * Fixation biologique du diazote * L'azote est un des éléments majeurs nécessaires à la croissance des plantes. Sa présence est nécessaire mais son excès est préjudiciable pour l'environnement (nitrates). Des normes existent, et les agriculteurs doivent effectuer des apports précis (compost, fumier, engrais
        • Activités de chimie du secondaire avec une composante environnementale: Analyse colorimétrique ionique à coût réduitplugin-autotooltip__default plugin-autotooltip_bigActivités de chimie du secondaire avec une composante environnementale: Analyse colorimétrique ionique à coût réduit

          Article : High School Chemistry Activities with an Environmental Concern: Cost-Effective Colorimetric Ion Analysis Zahra Arzani and Hassan Hazarkhani, J. Lab. Chem. Educ., 2017, 5(1), pp 9-12 DOI: 10.5923/j.jlce.20170501.03 résumé de F.H. 2017-2018
        • Identification de pigments végétaux : activité et situation d'apprentissageplugin-autotooltip__default plugin-autotooltip_bigIdentification de pigments végétaux : activité et situation d'apprentissage

          Plant Pigment Identification: A Classroom and Outreach Activity Kathleen C. A. Garber et al J. Chem. Educ., 2013, 90 (6), pp 755–759 DOI: 10.1021/ed200823t résumé de S.P. 2014-2015

          Objectif de l'article

          Séance de laboratoire sur l'identification de composés chimiques particuliers, les anthocyanines, colorants naturels des plantes.
        • Master chimie à finalité didactiqueplugin-autotooltip__default plugin-autotooltip_bigMaster chimie à finalité didactique

          Présentation de la finalité didactique, à l'intention des étudiants terminant le cycle de bachelier



          Cadre général

          * 30 crédits spécifiques = AESS chimie * Prépare au métier d’enseignant dans l’enseignement secondaire
        • Pourquoi une transformation chimique s’arrête-t-elle ? Les explications d’élèves de terminale Splugin-autotooltip__default plugin-autotooltip_bigPourquoi une transformation chimique s’arrête-t-elle ? Les explications d’élèves de terminale S

          Lien INRP (Actes des quatrièmes rencontres de l’ARDIST, 12-15, Octobre 2005, INRP, Lyon, 193-200. Kermen Isabelle, Laboratoire de Didactique des Sciences Physiques, Université Paris 7, Paris - Résumé de N.S., 2008-2009
        • Glucidesplugin-autotooltip__default plugin-autotooltip_bigGlucides

          FIXME

          * équivalent chimique simplifié (glucose, fructose,...) * conversion énergie, stœchiométrie avec H2O, O2, CO2,... * limites théoriques de la photosynthèse * production, consommation

          Références

          * The Dose Makes the Poison: Sugar and Obesity in the United States – a Review Samir Faruque, Janice Tong, Vuk Lacmanovic, Christiana Agbonghae, Dulce M. Minaya, and Krzysztof Czaja, Pol J Food Nutr Sci. 2019; 69(3): 219–233. DOI: 10.31883/pjfns/110735
        • Une étude de la compréhension des étudiants de chimie de première année (ens. sup.) sur la concentration des solutionsplugin-autotooltip__default plugin-autotooltip_bigUne étude de la compréhension des étudiants de chimie de première année (ens. sup.) sur la concentration des solutions

          A study of first-year chemistry students’ understanding of solution concentration at the tertiary level, Kevin de Berg, Chem. Educ. Res. Pract., 2012, 13, 8-16. Résumé de A.P., 2011-2012. Article d'intérêt didactique

          Les différents concepts en chimie sont souvent mal compris voir incompris, et provoquent chez les étudiants de nombreuses difficultés à réussir les cours de chim…
        • Les séries télévisées médicales comme études de cas en biochimieplugin-autotooltip__default plugin-autotooltip_bigLes séries télévisées médicales comme études de cas en biochimie

          Television Medical Dramas as Case Studies in Biochemistry, Julie T. Millard, Journal of Chemical Education • Vol. 86 No. 10 • October 2009 • 1216-1218. Résumé de M.G., 2010-2011.

          Introduction

          Le cours biochimie a généralement un rythme soutenu. Les étudiants sont souvent tellement occupés à prendre des notes qu'ils ne réfléchissent pas au sujet du cours. Une rupture de la leçon avec de courtes périodes, obligeant les élèves à ré…
        • Atome et molécule : étude des représentations d'étudiants du secondaire supérieur françaisplugin-autotooltip__default plugin-autotooltip_bigAtome et molécule : étude des représentations d'étudiants du secondaire supérieur français

          Atom and molecule: upper secondary school French students' representations in long-term memory(texte intégral disponible), Aytekin Cokelez et Alain Dumon, Chemistry Education Research and Practice, 2005, 6 (3), 119-135) Résumé de A.W., 2006-2007 - Article d'intérêt didactique. (accès gratuit possible via le site de la RSC)
        • Chimie – Sciences de base – UAA 8 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 8 – Troisième degré

          Grandes classes de réactions chimiques (acide-base, oxydoréduction, précipitation)

          Compétences à développer

          * Décrire une réaction de précipitation comme une réaction de recombinaison d’ions, une réaction acide base comme un transfert de protons, une oxydoréduction comme un transfert d’électrons
        • Recherche sur l'enseignement de la chimie - De l'empirisme personnel aux données probantes, à la théorie et à la pratique éclairéeplugin-autotooltip__default plugin-autotooltip_bigRecherche sur l'enseignement de la chimie - De l'empirisme personnel aux données probantes, à la théorie et à la pratique éclairée

          FIXME ; compléter et ajouter à biblio-didactique-chimie

          Voir aussi (accès restreint) :

          * two-tier multiple choice diagnostic instruments (questions à choix multiple avec justification)
        • Ressources en enseignement de la chimieplugin-autotooltip__default plugin-autotooltip_bigRessources en enseignement de la chimie

          * Unités d’acquis d’apprentissage * Vue globale des programmes : * Sciences générales - Tableau synoptique de chimie - FWB * Sciences de base - Tableau synoptique de chimie - FWB * Tableaux synoptiques du SEGEC (enseignement catholique)

          * Glossaire de termes usuels en chimie * Ligne du temps de la chimie * Sélection d'articles en didactique de la chimie * Publications intéressantes (résumés)

          * Des informations ou désinformation…
        • Préparer les étudiants à bénéficier d’une activité de recherche de base au laboratoire : guide et suggestionplugin-autotooltip__default plugin-autotooltip_bigPréparer les étudiants à bénéficier d’une activité de recherche de base au laboratoire : guide et suggestion

          Preparing students to benefit from inquiry-based activities in de chemistry laboratory : guidelines and suggestions, Laura B.Bruck and Marcy H. towns, Journal of chemical education, Vol 86 N°7 july 2009 - Résumé de M.P., 2009-2010

          Les activités de recherche au laboratoire sont indispensables pour enseigner les sciences. Il s’agit d’une méthode pédagogique qui combine à la fois : activit…
        • Chimie – Sciences générales – UAA 2 – Deuxième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 2 – Deuxième degré

          La réaction chimique : approche qualitative

          Compétences à développer

          * Réaction chimique * A partir de l’observation d’un phénomène chimique, décrire le réarrangement moléculaire et traduire la réaction chimique par une équation pondérée.
        • Généralités sur l'agrégation et les masters à finalité didactique en Faculté des Sciencesplugin-autotooltip__default plugin-autotooltip_bigGénéralités sur l'agrégation et les masters à finalité didactique en Faculté des Sciences

          wiki du service de didactique des disciplines scientifiques * lien direct :
        • Enseigner les composés organiques avec un jeu utilisant des notes collantes sur le frontplugin-autotooltip__default plugin-autotooltip_bigEnseigner les composés organiques avec un jeu utilisant des notes collantes sur le front

          Article Teaching Classes of Organic Compounds with a Sticky Note on Forehead Game Kevin P. O’Halloran, J. Chem. Educ., 2017 DOI:10.1021/acs.jchemed.7b00165 résumé de F.H. 2017-2018

          Introduction

          L’auteur de l’article, professeur de chimie, s’est rendu compte que la mémorisation des groupements chimiques en chimie organique se relevait être difficile pour les élèves. Il s’est demandé comment rendre l’appr…
        • Plutoniumplugin-autotooltip__default plugin-autotooltip_bigPlutonium

          Stabilité chimique

          * A new stable form of plutonium discovered at the ESRF 18/10/2019 * A new stable form of plutonium discovered at the ESRF * A novel meta‐stable pentavalent plutonium solid phase on the pathway from aqueous Pu(VI) to PuO2 nanoparticles - Kvashnina - - Angewandte Chemie International Edition - Wiley Online Library Kvashnina K. O. et al, Angewandte Chemie, DOI: 10.1002/anie.201911637
        • Deux types de problèmes conceptuels dans l’enseignement de la chimieplugin-autotooltip__default plugin-autotooltip_bigDeux types de problèmes conceptuels dans l’enseignement de la chimie

          Two Kinds of Conceptual Problems in Chemistry Teaching + supplement, Zuzana Haláková and Miroslav Proksa, Journal of Chemical Education Vol. 84 No. 1 January 2007, p 172-174. Résumé de L.B., 2010-2011. Article d'intérêt didactique
        • La magie chimique de J.K. Rowlingplugin-autotooltip__default plugin-autotooltip_bigLa magie chimique de J.K. Rowling

          The Chemical Wizardry of J.K. Rowling, Copes J.S., J. Chem. Ed. 83(10), 2006, 1479-1483. Résumé de V.L., 2009-2010.

          En parcourant les 6 volumes des aventures d’Harry Potter, l’auteur a mis en évidence une chimie explicable et sérieuse avec des phénomènes tels que des bulles, des étincelles, des flammes colorées,… IL y a puisé beaucoup d’inspiration pour des démonstrations chimiques de magie pour des classes d’élèves ou des camps en établissant des connections …
        • Pourquoi demander pourquoi ?plugin-autotooltip__default plugin-autotooltip_bigPourquoi demander pourquoi ?

          Article : Why Ask Why? Melanie M. Cooper, J. Chem. Educ., 2015, 92 (8), pp 1273–1279 DOI: 10.1021/acs.jchemed.5b00203 résumé de C.M. 2015-20162015-2016

          Sujet

          Dans cet article, l’auteur dit qu’il est important d’aider les étudiants à construire des explications mécanistiques et causales des phénomènes, c’est-à-dire, aider les étudiants à utiliser leur compréhension des interactions au niveau moléculaire afin d’expliquer et prédire les événements se produisant au …
        • “Quantifying the Soda Geyser”plugin-autotooltip__default plugin-autotooltip_big“Quantifying the Soda Geyser”

          Quantifying the Soda Geyser Christopher J. Huber and Aaron M. Massari, J. Chem. Educ., 2014, 91 (3), pp 428–431 DOI: 10.1021/ed300694n résumé de N.M. 2014-2015

          Cet article se propose de décrire les phénomènes mis en jeu lors de l’ajout d’un Mentos® dans une bouteille de Coca®, formant ainsi le fameux « Soda Geyser ». Pour ce faire, un raisonnement déductif (essais-erreurs) sera proposé aux élèves.
        • Chimie – Sciences générales – UAA 10 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 10 – Troisième degré

          Les réactions avec transfert : les réactions acide-base et d’oxydoréduction

          Compétences à développer

          * Décrire, expliquer et prévoir un phénomène chimique relevant d’une réaction de transfert à l’aide de modèles scientifiques.
        • Protoxyde d'azoteplugin-autotooltip__default plugin-autotooltip_bigProtoxyde d'azote

          * Protoxyde d’azote * Nitrous oxide * Nitrous oxide - pubchem * Nitrous oxide FAQ

          Utilisation grand public : dans les siphons pour crème chantilly, espumas

          lien

          Usage comme drogue

          lien : Detail from a satirical print from 1830 depicting Humphry Davy administering a dose of Laughing Gas to a woman while Count Rumford looks on (cropped out of the picture above), above the caption
        • Chimie – Sciences de base – UAA 2 – Deuxième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 2 – Deuxième degré

          La réaction chimique : approche qualitative

          Compétences à développer

          * Réaction chimique * A partir de l’observation d’un phénomène chimique, décrire le réarrangement moléculaire et traduire la réaction chimique par une équation pondérée
        • Vidéos pour le cours de chimie sciences généralesplugin-autotooltip__default plugin-autotooltip_bigVidéos pour le cours de chimie sciences générales





          Cette page reprend des références de vidéos utilisables dans un cours de chimie “Sciences générales”, suivant le programme du réseau officiel de la FWB. Ces vidéos sont évidemment tout aussi exploitables pour un autre cours de chimie (autre programme, sciences …
        • Explorations cinétiques du geyser Bonbon-Sodaplugin-autotooltip__default plugin-autotooltip_bigExplorations cinétiques du geyser Bonbon-Soda

          Article Kinetic Explorations of the Candy–Cola Soda Geyser Trevor P. T. Sims and Thomas S. Kuntzleman, J. Chem. Educ., 2016, 93 (10), pp 1809–1813 DOI: 10.1021/acs.jchemed.6b00263 résumé de E.M. 2016-2017

          Cet article aborde l’étude cinétique de la réaction responsable de l’effet geyser du mélange « mentos/boisson gazeuse ».
        • Dosage et titrationplugin-autotooltip__default plugin-autotooltip_bigDosage et titration

          FIXME : à formater et illustrer. Ajouter des liens

          Introduction

          Le but de cette manipulation est de vous familiariser avec la technique de dosage ou titrage d'acides ou de bases. Pour cela, il est indispensable :

          * de connaître l'utilisation de chaque élément de la verrerie mise à votre disposition
        • Introduction de méthodologies basées sur des enquêtes lors de la formation initiale d'enseignants du secondaire en utilisant un problème ouvert sur les transformations chimiquesplugin-autotooltip__default plugin-autotooltip_bigIntroduction de méthodologies basées sur des enquêtes lors de la formation initiale d'enseignants du secondaire en utilisant un problème ouvert sur les transformations chimiques

          Article Introducing Inquiry-Based Methodologies during Initial Secondary Education Teacher Training Using an Open-Ended Problem about Chemical Change, Iñigo Rodríguez-Arteche and M. Mercedes Martínez-Aznar, J. Chem. Educ., 2016, 93 (9), pp 1528–1535 DOI: 10.1021/acs.jchemed.5b01037 résumé de E.M. 2016-2017
        • Recette de la "Crema di Limoncello della Camorra"plugin-autotooltip__default plugin-autotooltip_bigRecette de la "Crema di Limoncello della Camorra"

          Bella Simone, brillante avocate de Palerme, a défendu en octobre 2004 Luciano Ferretti, un “parrain de la Camorra”, lui permettant d'échapper à la prison. Par reconnaissance, celui-ci lui révéla sur son lit de mort la recette familiale de la
        • Ethanol, éthanolplugin-autotooltip__default plugin-autotooltip_bigEthanol, éthanol

          * The Chemistry of a Hangover, 01/01/2016
        • Pourquoi l'énergie d'ionisation diminue-t-elle lorsque la taille de l'atome augmente ?plugin-autotooltip__default plugin-autotooltip_bigPourquoi l'énergie d'ionisation diminue-t-elle lorsque la taille de l'atome augmente ?

          * Cf. chemistry.stackexchange : Why does the ionization energy decrease anytime the atom size increases? * Question gérée par S.C. 2019-2020

          L'énergie d'ionisation (EI) correspond à l'énergie qu'il faut appliquer pour arracher un électron à un atome. Le rayon atomique des atomes influence cette énergie d'ionisation de manière inversement proportionnelle.$1s^2 2s^2$$1s^2 2s^2 2p^1$
        • Élaboration et mise en œuvre d'une expérience simple et engageante de neutralisation des pluies acides et d'une vidéo d'animation correspondante pour les étudiants en chimieplugin-autotooltip__default plugin-autotooltip_bigÉlaboration et mise en œuvre d'une expérience simple et engageante de neutralisation des pluies acides et d'une vidéo d'animation correspondante pour les étudiants en chimie

          Development and Implementation of a Simple, Engaging Acid Rain Neutralization Experiment and Corresponding Animated Instructional Video for Introductory Chemistry Students Danielle Rand, Craig J. Yennie, Patrick Lynch, Gregory Lowry, James Budarz, Wenlei Zhu, and Li-Qiong Wang, J. Chem. Educ., 2016, 93 (4), pp 722–728 DOI: …
        • Boreplugin-autotooltip__default plugin-autotooltip_bigBore

          FIXME

          * La betterave est très sensible à la carence en cet oligo-éléments (maladie du cœur noir) * * L'élément (atome) apporté est le bore. Il est sous forme acide borique via une substance appelée bore éthanolamine

          * l'acide borique est utilisé pour traiter les conjonctivites (?)
        • La chimie des chipsplugin-autotooltip__default plugin-autotooltip_bigLa chimie des chips

          Learning chemistry and beyond with a lesson plan on potato crisps, which follows a socio-critical and problem-oriented approach to chemistry lessons, Ralf Marks, Stefanie Bertram and Ingo Eilks, Chem. Educ. Res. Pract., 2008, 9, 267-276. Sur base d'un résumé de A. V. V., AESS 2009-2010. (accès gratuit possible via le site de la RSC)

          Le problème

          L’article part d’une étude réalisée en Allemagne. Le constat est le même que partout ailleurs :
        • Terminologie utilisée dans l'enseignementplugin-autotooltip__default plugin-autotooltip_bigTerminologie utilisée dans l'enseignement

          Lexique

          Agrégation de l'enseignement secondaire inférieur ou régendat

          études conduisant à l'obtention du grade d'agrégé de l'enseignement secondaire inférieur

          Agrégation de l'enseignement secondaire inférieur
        • Orplugin-autotooltip__default plugin-autotooltip_bigOr

          * fr:Or * Gold

          Objets en or

          * America_(toilet) * * vol le 14/09/2019 * *
        • Sciences de base - Tableau synoptique de chimie - FWBplugin-autotooltip__default plugin-autotooltip_bigSciences de base - Tableau synoptique de chimie - FWB

          Les indications proposées des nombres de périodes le sont pour les sous-titres et sous-sous-titres énoncés jusqu'à l'indication suivante. Pour chaque unité d'acquis d'apprentissage, il est souvent proposé de consacrer une période à des évaluations formatives et une période à l'évaluation sommative, et parois un peu moins ou un peu plus.
        • Efficacité énergétique des transportsplugin-autotooltip__default plugin-autotooltip_bigEfficacité énergétique des transports

          Vocabulaire, généralités

          * Metabolic cost of transport * Cost of transport * Efficacité énergétique dans les transports * Energy efficiency in transport * Animal locomotion * Exercise Physiology * Energy * Human Performance * nutritional efficiency

          Références

          Humain :

          * The mechanics and energetics of human walking and running: a joint level perspective Dominic James Farris and Gregory S. SawickiJ R Soc Interface. 2012 Jan 7; 9(66): …
        • PhysicoChimie Iplugin-autotooltip__default plugin-autotooltip_bigPhysicoChimie I

          Bachelier en sciences chimiques, deuxième année, 30 H cours et 30 H travaux pratiques, en co-suppléance avec P. Damman et S. Gabriele)

          FIXME : contenus à ajouter sur la partie “phénomènes de transport”.

          Références

          *
        • La chimie dans les films contemporainsplugin-autotooltip__default plugin-autotooltip_bigLa chimie dans les films contemporains

          Almost Like Weighing Someone’s Soul”: Chemistry in Contemporary Film, Donald J. Wink, J. Chem. Ed.Vol. 78 No. 4 April 2001, pp 481-483. Résumé de V.L., 2009-2010

          L’utilisation de courts clips vidéo de différents films populaires constitue un moyen ludique de présenter des exemples « vivants » de théories ou faits importants dans l’enseignement de la chimie. Exemples de films utilisés : Apollo 13, A la poursuite de l’arche perdue, Légende d’automne, the ro…
        • Activités de vulgarisation et diffusion du savoir scientifiqueplugin-autotooltip__default plugin-autotooltip_bigActivités de vulgarisation et diffusion du savoir scientifique

          Cours préparatoires

          Manipulations, démonstrations

          * Dosage et titration, TP “classique” de chimie sur les réactions acide-base * Qui a inventé l'eau chaude, atelier autour de la calorimétrie dans une cuisine

          Conférences
        • Atomic Tiles (tuiles atomiques) : Ressources à manipuler pour explorer la liaison et la structure moléculaireplugin-autotooltip__default plugin-autotooltip_bigAtomic Tiles (tuiles atomiques) : Ressources à manipuler pour explorer la liaison et la structure moléculaire

          Article : Atomic Tiles: Manipulative Resources for Exploring Bonding and Molecular Structure , Alan L. Kiste, Rebecca G. Hooper, Gregory E. Scott, and Seth D. Bush, J. Chem. Educ., 2016, 93 (11), pp 1900–1903 DOI: 10.1021/acs.jchemed.6b00361 sur base de résumés de M.L. (2016-2017) et E.C. (2017-2018)
        • Développement de la compréhension qu’ont les étudiants de la notion de transformation chimiqueplugin-autotooltip__default plugin-autotooltip_bigDéveloppement de la compréhension qu’ont les étudiants de la notion de transformation chimique

          Developing students' understanding of chemical change: What should we be teaching?, P. Johnson, Chemistry Education: Research and Practice in Europe, 2000, Vol.1, N°1, pp 77-90. DOI: 10.1039/A9RP90008J Résumé de V.B., 2008-2009. (accès gratuit possible via le site de la RSC)
        • Convention de stage : modèle et directivesplugin-autotooltip__default plugin-autotooltip_bigConvention de stage : modèle et directives

          wiki du service de didactique des disciplines scientifiques * lien direct :
        • Une méthode efficace pour présenter le tableau périodique comme un jeu de mots croisés au niveau secondaireplugin-autotooltip__default plugin-autotooltip_bigUne méthode efficace pour présenter le tableau périodique comme un jeu de mots croisés au niveau secondaire

          Article An Effective Method of Introducing the Periodic Table as a Crossword Puzzle at the High School Level Sushama D. Joag, J. Chem. Educ., 2014, 91 (6), pp 864–867 DOI: 10.1021/ed400091w résumé de J.-L.D. 2016-2017

          L’article présente une nouvelle méthode d’apprentissage pour introduire le tableau périodique aux élèves du secondaire. Le public essentiellement visé est celui des ado…
        • A quel point ton essence est-elle verte ? Création et comparaison de biocarburantsplugin-autotooltip__default plugin-autotooltip_bigA quel point ton essence est-elle verte ? Création et comparaison de biocarburants

          How green is your fuel ? Creation and comparison of automotive biofuels, Eugene P. Wagner, Maura A. Koehle, Todd M. Moyle, and Patrick D. Lambert, Journal of Chemical Education, 2010, 87(7), 711-713. Résumé de N.L., 2010-2011

          L’avenir des biocarburants
        • Les animations peuvent-elles remplacer les méthodes traditionnelles d’enseignement?plugin-autotooltip__default plugin-autotooltip_bigLes animations peuvent-elles remplacer les méthodes traditionnelles d’enseignement?

          Partie I - préparation et tests

          Can animations effectively substitute for traditional teaching methods? Part I: preparation and testing of materials Roberto Ma. Gregorius, Rhodora Santos, Judith B. Dano and Jose J. Gutierrez Chem. Educ. Res. Pract., 2010,11, 253-261 DOI: 10.1039/C0RP90006K Résumé de E.V., 2011-2012
        • Ressources pour la création de séquences vidéos et l'enseignement à distanceplugin-autotooltip__default plugin-autotooltip_bigRessources pour la création de séquences vidéos et l'enseignement à distance

          Conseils généraux pour la conception

          * conseils, longueurs, styles,... * Planifier, réaliser et diffuser des vidéos éducatives : lignes directrices et astuces pour les enseignants, Caroline Cormier, Edward Awad, Yann Brouillette et Véronique Turcotte (canada). Article reprenant des exemples de capsule en chimie
        • Fil RSS des derniers articles parus dans Journal of Chemical Educationplugin-autotooltip__default plugin-autotooltip_bigFil RSS des derniers articles parus dans Journal of Chemical Education

          Fil RSS des derniers articles parus dans Journal of Chemical Education
        • Une introduction à l'apprentissage en petits groupesplugin-autotooltip__default plugin-autotooltip_bigUne introduction à l'apprentissage en petits groupes

          An Introduction to Small-Group Learning, Melanie M. Cooper, Department of Chemistry, Clemson University. chapitre 10 du “Chemists'guide to effective teaching”, Norbert J. Pienta, Melanie M. Cooper, Thomas J. Greenbowe, Pearson Prentice Hall 2005. Résumé de A.P., 2011-2012.
        • Magnésiumplugin-autotooltip__default plugin-autotooltip_bigMagnésium

          FIXME : à compléter

          * divers * Sulfate de magnésium, sel d'Epsom (heptahydrate de sulfate de magnésium) et sel anhydre d'Epsom, dont l'obtention peut être constatée via une perte en eau (diminution de la masse) * Talc : silicate de magnésium doublement hydroxylé :
        • Compréhension par les élèves des titrages et des phénomènes acide-base reliésplugin-autotooltip__default plugin-autotooltip_bigCompréhension par les élèves des titrages et des phénomènes acide-base reliés

          High school students’ understanding of titrations and related acid-base phenomena, K. Sheppard, Chemistry Education Research and Practice, 2006, 7 (1), 32-45. Résumé de A.F., 2011-2012.

          L’auteur, K. Sheppard, a voulu mettre en avant les problèmes qui causent l’incompréhension des étudiants face aux phénomènes acide-base qui régissent les titrages. Les causes mises en avant par l’auteur sont l’incompréhension par les …
        • Démonstrations chimiques et attention visuelle : La configuration est elle importante? Mise en évidence issue d'une étude du suivi oculaire, en approche double aveugleplugin-autotooltip__default plugin-autotooltip_bigDémonstrations chimiques et attention visuelle : La configuration est elle importante? Mise en évidence issue d'une étude du suivi oculaire, en approche double aveugle

          Article Chemistry Demonstrations and Visual Attention: Does the Setup Matter? Evidence from a Double-Blinded Eye-Tracking Study Andreas Nehring and Sebastian Busch, J. Chem. Educ., 2018, 95 (10), pp 1724–1735 DOI: 10.1021/acs.jchemed.8b00133 résumé de M.M.M. 2018-2019
        • Sciences générales - Tableau synoptique de chimie - FWBplugin-autotooltip__default plugin-autotooltip_bigSciences générales - Tableau synoptique de chimie - FWB

          Les indications proposées des nombres de périodes le sont pour les sous-titres et sous-sous-titres énoncés jusqu'à l'indication suivante. Pour chaque unité d'acquis d'apprentissage, il est souvent proposé de consacrer une période à des évaluations formatives et une période à l'évaluation sommative. Mais par exemple pour l'uaa 6 ce sera deux fois une demi période, tandis que pour l'uaa 10, les durées d'évaluation sont de deux périodes.…
        • Un spectromètre simple construit par des élèves pour étudier le rayonnement infrarouge et les gaz à effet de serreplugin-autotooltip__default plugin-autotooltip_bigUn spectromètre simple construit par des élèves pour étudier le rayonnement infrarouge et les gaz à effet de serre

          Article A Simple, Student-Built Spectrometer To Explore Infrared Radiation and Greenhouse Gases Mitchell R. M. Bruce, Tiffany A. Wilson, Alice E. Bruce, S. Max Bessey, and Virginia J. Flood, J. Chem. Educ., 2016, 93 (11), pp 1908–1915 DOI: 10.1021/acs.jchemed.6b00047 résumé de M.L. 2016-2017
        • L’importance de la métastabilité cinétique: quelques exemples communsplugin-autotooltip__default plugin-autotooltip_bigL’importance de la métastabilité cinétique: quelques exemples communs

          Article The Importance of Kinetic Metastability: Some Common Everyday Examples William B. Jensen, J. Chem. Educ., 2015, 92 (4), pp 649–654 DOI: 10.1021/ed500743r résumé de G.V. 2015-2016

          Introduction

          Les manuels de thermodynamiques sont susceptibles de laisser aux étudiants une impression erronée car ils indiquent que la seule exigence pour qu’une réaction chimique spontanée thermodynamiquement se produise est une valeur …
        • Calculation methods applied to chemistryplugin-autotooltip__default plugin-autotooltip_bigCalculation methods applied to chemistry

          Synopsis (english)

          Mathematical prerequisites

          Programming bases and tools

          * Python programming language * LearnPython.org interactive tutorial with code execution * DataCamp free course "Intro to Python for Data Science" * Python 3 Tutorial, interactive, with code use in web browser * MOOCs (massive open online courses) :
          • Numerical solutions of PDEplugin-autotooltip__default plugin-autotooltip_bigNumerical solutions of PDE

            * Finite element method * Finite volume method * Boundary element method * Spectral method * Multigrid methods * ...

            * Numerical partial differential equations

            However, the finite difference method can be more easliy applied to a lot of classical PDE. In this method, functions are represented by their values at certain grid points and derivatives are approximated through differences in these values.$$\frac{\partial T}{\partial t} = \kappa\left(\frac{…
          • Eigenvalues and eigenvectorsplugin-autotooltip__default plugin-autotooltip_bigEigenvalues and eigenvectors

            * Eigenvalues and eigenvectors * Important matrix properties * Hermitian, orthogonality,...

            * Eigenvalue algorithm * Power iteration, a simple numerical algorithm producing a number $\lambda$, the greatest (in absolute value) eigenvalue of a matrix $A$, and the corresponding eigenvector $v$$Av=\lambda v$
          • Root findings : equations f(x) = 0plugin-autotooltip__default plugin-autotooltip_bigRoot findings : equations f(x) = 0

            * Polynomial equations : Bairstow's method is an efficient algorithm for finding the roots of a real polynomial of arbitrary degree * Polynomials in NumPy * polynomial module, including polyroots(c) to compute the roots of a polynomial.

            * Bisection method (dichotomy) : very simple and robust method, but relatively slow. It assumes continuity of the function, and obtain one roots. The algorithm is based on a
          • System of linear equationsplugin-autotooltip__default plugin-autotooltip_bigSystem of linear equations

            Time_complexityi.e. Theory

            * System_of_linear_equations * Gaussian_elimination, Gauss and Gauss-Jordan eliminations (diagonalization, triangularization) * Pivot_element, pivoting * LU_decomposition * Triangular_matrix

            * Chapter 2 in the book “Numerical Recipes” : * 2.0 Introduction * 2.1 Gauss-Jordan Elimination
          • Numerical integrationplugin-autotooltip__default plugin-autotooltip_bigNumerical integration

            Error estimation

            * Equally spaced methods : * Numerical_integration * Trapezoidal_rule * Newton–Cotes_formulas * Simpson's rule and composite Simpson's rule

            * If intervals between interpolation points vary : * Gaussian_quadrature

            * Chapter 4 in the book “Numerical Recipes” : Integration of Functions * 4.0 Introduction * 4.1 Classical Formulas for Equally Spaced Abscissas
          • Integration of Ordinary Differential Equationsplugin-autotooltip__default plugin-autotooltip_bigIntegration of Ordinary Differential Equations

            * Ordinary Differential Equations (ODE, ODEs) * Numerical methods for ordinary differential equations * Euler method * Runge-Kutta methods * « most widely known member of the Runge–Kutta family is generally referred to as “RK4”, “classical Runge–Kutta method” or simply as “the Runge–Kutta method »
        • Résolution des problèmes en chimie : pourquoi les élèves ont-ils des problèmes et que peut-on faire pour les aider ?plugin-autotooltip__default plugin-autotooltip_bigRésolution des problèmes en chimie : pourquoi les élèves ont-ils des problèmes et que peut-on faire pour les aider ?

          Solving Word Problems in Chemistry: Why Do Students Have Difficulties and What Can Be Done to Help?, Diane M. Bunce, chap 9 du “Chemists'guide to effective teaching”, Pearson Prentice Hall 2005. Résumé de E.V., 2011-2012.
        • Mettre l’accent sur la représentation à plusieurs niveaux afin d’augmenter la compréhension des étudiants concernant les changements se produisant durant des réactions chimiquesplugin-autotooltip__default plugin-autotooltip_bigMettre l’accent sur la représentation à plusieurs niveaux afin d’augmenter la compréhension des étudiants concernant les changements se produisant durant des réactions chimiques

          Emphasizing Multiple Levels of Representation To Enhance Students'Understandings of the Changes Occuring during Chemical Reactions, A.L. Chandrasegaran and David F. Treagust, J. Chem. Educ. December 2009 vol. 86 N°12, 1433-1436. Résumé de T.D., 2009-2010.
        • Plombplugin-autotooltip__default plugin-autotooltip_bigPlomb

          FIXME

          Tension de vapeur du plomb

          Bien que réputé toxique, le plomb a une tension de vapeur très faible, qui a été difficile à mesurer :

          * The vapour pressure of lead.—I Alfred Charles Egerton, published 01 June 1923 DOI: 10.1098/rspa.1923.0071

          Recyclage des batteries au plomb
        • La chimie des bonbons: une approche douce pour enseigner aux sections non scientifiquesplugin-autotooltip__default plugin-autotooltip_bigLa chimie des bonbons: une approche douce pour enseigner aux sections non scientifiques

          Article : Chemistry of Candy: A Sweet Approach to Teaching Nonscience Majors Jennifer Logan Bayline, Halie M. Tucci, David W. Miller, Kaitlin D. Roderick, and Patricia A. Brletic, J. Chem. Educ., 2018, 95 (8), pp 1307–1315 DOI: 10.1021/acs.jchemed.7b00739 résumé de A.W. 2018-2019
        • Énergie d'ionisationplugin-autotooltip__default plugin-autotooltip_bigÉnergie d'ionisation

          Voir aussi :

          * Glossaire : ionisation (énergie d') * Énergie d'ionisation * Liste d'énergies d'ionisation

          Pourquoi l'énergie d'ionisation diminue-t-elle lorsque la taille de l'atome augmente

          * Why does the ionization energy decrease anytime the atom size increases?

          Graphique

          Code Python :

          from mendeleev import element import matplotlib.pyplot as plt

          x, y = range(1,108), [element(i).ionenergies[1] for i in range(1,108)] for i in range(1,108): print(x[i-…
        • Étudier la cohérence entre et dans les modèles mentaux de l'étudiant pour la structure atomiqueplugin-autotooltip__default plugin-autotooltip_bigÉtudier la cohérence entre et dans les modèles mentaux de l'étudiant pour la structure atomique

          Studying the consistency between and within the student mental models for atomic structure Nikolaos Zarkadis, George Papageorgiou and Dimitrios Stamovlasis, Chem. Educ. Res. Pract., 2017, 18, 893-902, DOI: 10.1039/C7RP00135E Résumé de V.L., 2017-2018 (accès gratuit possible via le site de la RSC)
        • Influence du Grec ancien sur la terminologie en Chimieplugin-autotooltip__default plugin-autotooltip_bigInfluence du Grec ancien sur la terminologie en Chimie

          Influences of Ancient Greek on Chemical Terminology, Peter Loyson, Journal of Chemical Education, Vol. 86 No. 10 October 2009, 1195-1199. Résumé de L.M., 2009-2010

          La civilisation Grecque ancienne a prospéré de -700 ans avant notre ère jusqu’à 100 ans après et est, à juste titre, qualifiée de classique pour ses contributions majeures aux différents savoirs humains, spécialement dans les domaines de la philosophie, l’astronomie, la littérat…
        • Signification du concept de la mole pour les étudiants et les professeurs du secondaireplugin-autotooltip__default plugin-autotooltip_bigSignification du concept de la mole pour les étudiants et les professeurs du secondaire

          Unpacking the Meaning of the Mole Concept for Secondary School Teachers and Students Su-Chi Fang, Christina Hart, and David Clarke, J. Chem. Educ., 2014, 91 (3), pp 351–356 DOI: 10.1021/ed400128x résumé de J.V. 2014-2015

          La mole est un concept fondamental en chimie quantitative, et pourtant des recherches ont démontré que l’apprentissage de ce concept était des plus difficiles. Cet article contient une re…
        • Thermodynamique et réactions chimiquesplugin-autotooltip__default plugin-autotooltip_bigThermodynamique et réactions chimiques

          Source de données

          * Tables incluant des données utiles pour les réactions : * * * *

          Les pages Wikipédia des substances reprennent aussi des données utilisables.
        • Publications intéressantes en didactique de la chimie, mais pas seulementplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes en didactique de la chimie, mais pas seulement

          La plupart des résumés de publications sont issus d'analyses d'articles effectuées par des étudiants dans le cadre des études d'AESS en chimie ou de bacheliers/masters en chimie (les initiales et années sont alors indiquées), pour des publications souvent issues de cette
        • La biologie et la chimie du brassage : un cours interdisciplinaireplugin-autotooltip__default plugin-autotooltip_bigLa biologie et la chimie du brassage : un cours interdisciplinaire

          The Biology and Chemistry of Brewing: An Interdisciplinary Course Paul D. Hooker, William A. Deutschman, and Brian J. Avery, J. Chem. Educ., 2014, 91 (3), pp 336–339 DOI: 10.1021/ed400523m résumé de S.P. 2014-2015

          Dans cet article, les auteurs, exposent les principes d’un cours interdisciplinaire sur le thème de la brasserie, cours qu’ils ont mis en place depuis neuf ans et qui a la particularité de créer des liens concrets e…
        • Chimie "on the go" : revue d'applications pour smartphone en chimieplugin-autotooltip__default plugin-autotooltip_bigChimie "on the go" : revue d'applications pour smartphone en chimie

          Chemistry on the Go: Review of Chemistry Apps on Smartphones Diana Libman and Ling Huang, J. Chem. Educ., 2013, 90 (3), pp 320–325 DOI: 10.1021/ed300329e (résumé de D.D. 2014-2015)

          De nos jours, quasi tous les jeunes ont un smartphone. De nombreuses applications mobiles ont alors vu le jour. Elles recouvrent un large éventail de fonctionnalités et disciplines. Les plus importantes, et presque toutes gratuites liées à la chimi…
        • Gestion des stages de chimie en AESS et masters à finalité didactique
          • Enquête sur le raisonnement des étudiants face aux réactions acidobasiquesplugin-autotooltip__default plugin-autotooltip_bigEnquête sur le raisonnement des étudiants face aux réactions acidobasiques

            Investigating Students’ Reasoning about Acid–Base Reactions Melanie M. Cooper, Hovig Kouyoumdjian, and Sonia M. Underwood, J. Chem. Educ., 2016, 93 (10), pp 1703–1712 DOI: 10.1021/acs.jchemed.6b00417 Résumé de S.C., 2016-2017
          • Appareil microfluidique colorimétrique à bas coût, à base de papier et caméra pour téléphone portableplugin-autotooltip__default plugin-autotooltip_bigAppareil microfluidique colorimétrique à bas coût, à base de papier et caméra pour téléphone portable

            Article : Cost Effective Paper-Based Colorimetric Microfluidic Devices and Mobile Phone Camera Readers for the Classroom Myra T. Koesdjojo, Sumate Pengpumkiat, Yuanyuan Wu, Anukul Boonloed, Daniel Huynh, Thomas P. Remcho, and Vincent T. Remcho, J. Chem. Educ., 2015, 92 (4), pp 737–741 DOI: 10.1021/ed500401d résumé de R.D. BAB2 chimie 2018-2019
          • Approche basée sur les problèmes pour l'enseignement des laboratoires avancés de chimie et le développement de compétences de réflexion critique des étudiantsplugin-autotooltip__default plugin-autotooltip_bigApproche basée sur les problèmes pour l'enseignement des laboratoires avancés de chimie et le développement de compétences de réflexion critique des étudiants

            Article : Problem-Based Approach to Teaching Advanced Chemistry Laboratories and Developing Students’ Critical Thinking Skills, Joseph G. Quattrucci, J. Chem. Educ., 2018, 95 (2), pp 259–266 DOI: 10.1021/acs.jchemed.7b00558 résumé de J.D. 2017-2018
          • Fils RSSplugin-autotooltip__default plugin-autotooltip_bigFils RSS

            * Cliquez pour savoir ce qu'est un fil RSS * Consultez le code source de cette page pour obtenir les liens RSS

            Compound Interest

            éduscol physique-chimie

            pour la classe de cinquième

            pour la classe de quatrième

            pour la classe de troisième
          • Tableaux synoptiques du SEGEC (2017)plugin-autotooltip__default plugin-autotooltip_bigTableaux synoptiques du SEGEC (2017)

            Pour les sciences, et en particulier la chimie, le SEGEC (enseignement catholique) propose des tableaux synoptiques de ses programmes. Lien direct :

            Sciences de base

            Tableau synoptique de chimie

            * 1er degré
          • Création d'un environnement d'apprentissage positif par l'utilisation de clickers en classes de chimie dans le secondaireplugin-autotooltip__default plugin-autotooltip_bigCréation d'un environnement d'apprentissage positif par l'utilisation de clickers en classes de chimie dans le secondaire

            Creating a Positive Learning Environment with the Use of Clickers in a High School Chemistry Classroom, Fred Vital, J. Chem. Educ. 2012, 89, 470-473. Résumé de B.V.A., 2011-2012.

            Introduction

            Les clickers sont de petits dispositifs manuels, utilisés typiquement à l’Université pour répondre directement aux questions posées en classe. Bien que leur efficacité soit non conc…
          • Exploration des substances mystérieuses, X et Y: remettre en question l’opinion des étudiants sur la chimie acide-base et l’équilibre chimiqueplugin-autotooltip__default plugin-autotooltip_bigExploration des substances mystérieuses, X et Y: remettre en question l’opinion des étudiants sur la chimie acide-base et l’équilibre chimique

            Article Exploring the Mysterious Substances, X and Y: Challenging Students’ Thinking on Acid–Base Chemistry and Chemical Equilibrium Ingo Eilks, Ozcan Gulacar, and Jose Sandoval, J. Chem. Educ., 2018, 95 (4), pp 601–604 DOI: 10.1021/acs.jchemed.7b00404 résumé de A.-C. N. 2018-2019
          • Chimie – Sciences de base – UAA 5 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 5 – Troisième degré

            Les Liaisons chimiques

            Compétences à développer

            * A partir du modèle de Lewis et d’informations du tableau périodique des éléments, représenter une molécule avec ses liaisons
          • Chimie – Sciences de base – UAA 4 – Deuxième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 4 – Deuxième degré

            Caractériser un phénomène chimique

            Compétences à développer

            * Classer les phénomènes selon l’effet thermique associé (exothermique, endothermique, athermique) * Caractériser la vitesse de réaction sur base de critères qualitatifs
          • Le campus comme laboratoire vivant pour la durabilité: la connexion à la chimieplugin-autotooltip__default plugin-autotooltip_bigLe campus comme laboratoire vivant pour la durabilité: la connexion à la chimie

            Article Campus as a Living Laboratory for Sustainability: The Chemistry Connection T. Lindstrom and C. Middlecamp, J. Chem. Educ., 2017, 94 (8), pp 1036–1042, DOI: 10.1021/acs.jchemed.6b00624 résumé de F.P. 2017-2018

            C’est un article écrit par un chimiste et par un physicien. Il décrit l’enseignement dispensé par ceux-ci lors des 5 dernières années dans leur université et ce dans le cadre d’un cours de sciences …
          • La cuisine moléculaireplugin-autotooltip__default plugin-autotooltip_bigLa cuisine moléculaire

            L'alimentation serait à l'origine de nos capacités neuronales plus importantes : cf. Suzana Herculano-Houzel’s TED talk

            Situations d'apprentissage

            * la mayonnaise ratée * l'œuf est très souvent trop cuit : * le jaune devient verdâtre * le jaune est trop sec
          • « Exploring Matter » : Une exposition interactive et peu coûteuse sur la chimie, pour les muséesplugin-autotooltip__default plugin-autotooltip_big« Exploring Matter » : Une exposition interactive et peu coûteuse sur la chimie, pour les musées

            Article Exploring Matter: An Interactive, Inexpensive Chemistry Exhibit for Museums Steven Murov and Arnold Chavez, J. Chem. Educ., 2017, 94 (10), pp 1571–1579 DOI: 10.1021/acs.jchemed.6b01024 résumé de A.O. 2017-2018
          • Production en laboratoire de liqueur de citron (Limoncello) par macération conventionnelle et un système à deux seringues pour illustrer l'extraction dynamique rapide solide-liquideplugin-autotooltip__default plugin-autotooltip_bigProduction en laboratoire de liqueur de citron (Limoncello) par macération conventionnelle et un système à deux seringues pour illustrer l'extraction dynamique rapide solide-liquide

            Article Laboratory Production of Lemon Liqueur (Limoncello) by Conventional Maceration and a Two-Syringe System To Illustrate Rapid Solid–Liquid Dynamic Extraction Daniele Naviglio, Domenico Montesano, and Monica Gallo, J. Chem. Educ., 2015, 92 (5), pp 911–915 DOI: 10.1021/ed400379g résumé de J.D. 2016-2017
          • L'erreur de considérer ses élèves comme des Mendeleïev un seul jourplugin-autotooltip__default plugin-autotooltip_bigL'erreur de considérer ses élèves comme des Mendeleïev un seul jour

            Mistake of Having Students Be Mendeleev for Just a Day, Brett Criswell, J. Chem. Educ., 2007, 84 (7), p 1140 DOI: 10.1021/ed084p1140

            En apparence, expliquer aux élèves comment les éléments chimiques ont été classés peut paraître simple. On pourrait en effet se contenter de leur présenter les différents groupes (gaz, métaux, non-métaux, terreux), comme l'envisageait Lavoisier, en 1789. Mais cela présente deux lacunes : D'une pa…
          • Les animations peuvent-elles remplacer les méthodes traditionnelles d’enseignement?plugin-autotooltip__default plugin-autotooltip_bigLes animations peuvent-elles remplacer les méthodes traditionnelles d’enseignement?

            Partie II - potentiel pour un apprentissage différencié

            Can animations effectively substitute for traditional teaching methods? Part II: Potential for differentiated learning Roberto Ma. Gregorius, Rhodora Santos, Judith B. Dano and Jose J. Gutierrez Chem. Educ. Res. Pract., 2010,11, 262-266 DOI: 10.1039/C0RP90007A
          • Contenu pédagogique sur la cinétique chimique: sélection de critères pour aborder expérimentalement les conceptions intuitives des étudiantsplugin-autotooltip__default plugin-autotooltip_bigContenu pédagogique sur la cinétique chimique: sélection de critères pour aborder expérimentalement les conceptions intuitives des étudiants

            Article Pedagogical Content Knowledge of Chemical Kinetics: Experiment Selection Criteria To Address Students’ Intuitive Conceptions Ainoa Marzabal, Virginia Delgado, Patricia Moreira, Lorena Barrientos, and Jeannette Moreno, J. Chem. Educ., 2018, 95 (8), pp 1245–1249 DOI: 10.1021/acs.jchemed.8b00296 résumé de F.G. 2018-2019
          • Exercices sur l'empreinte carboneplugin-autotooltip__default plugin-autotooltip_bigExercices sur l'empreinte carbone

            FIXME : Carbon footprint

            * Empreinte carbone * Carbon footprint * Tonne of oil equivalent * Tonne of coal equivalent * * * * * * Émission de dioxyde de carbone

            Références académiques :

            * Towards a univ…
          • Glossaire de termes usuels de chimieplugin-autotooltip__default plugin-autotooltip_bigGlossaire de termes usuels de chimie

            Ce glossaire reprend principalement les termes chimiques utilisés dans le cours de chimie de l'enseignement secondaire belge (cf. les unités d'acquis d'apprentissage de chimie en sciences générales). Le niveau des définitions est adapté au niveau d'étude. L'ensemble est placé sous licence libre $\chi_{A}$
          • Héliumplugin-autotooltip__default plugin-autotooltip_bigHélium

            * Hélium * Helium

            Références

            * Nothing on Earth Can Replace Helium — and It’s in Peril The New York Times 04/09/2019
          • Minéralogie - Géologie - Roches - Mineraisplugin-autotooltip__default plugin-autotooltip_bigMinéralogie - Géologie - Roches - Minerais

            * fr:Portail:Minéraux_et_roches * fr:Roche : magmatiques, sédimentaires, métamorphiques * Rock (geology) * Igneous rock * Sedimentary rock * Metamorphic rock * Granite * Granodiorite * Diorite * Basalt * Dolérite

            * Ultramafic rock (ultrabasic rock) * Shale (schiste) * Sandstone (grès) * Limestone (calcaire)

            Pistes didactiques

            * composition chimique du sous-sol et nécessité d'amender pour l'agriculture
          • Le laboratoire dans l'enseignement de la chimie : trente ans d'expérience avec des développements, de l'implémentation et de la rechercheplugin-autotooltip__default plugin-autotooltip_bigLe laboratoire dans l'enseignement de la chimie : trente ans d'expérience avec des développements, de l'implémentation et de la recherche

            The laboratory in chemistry education : thirty years of experience with developments, implementation, and research, Avi Hofstein, Chem. Educ. Res. Pract., 2004, 5, 247-264. Résumé de A.F., 2011-2012. Article d'intérêt didactique
          • Enseignement de l’hypothèse d’Avogadro en aidant les étudiants à voir le monde autrementplugin-autotooltip__default plugin-autotooltip_bigEnseignement de l’hypothèse d’Avogadro en aidant les étudiants à voir le monde autrement

            Teaching Avogadro's Hypothesis and Helping Students to See the World Differently Brett Criswell, J. Chem. Educ., 2008, 85 (10), p 1372 DOI: 10.1021/ed085p1372 Résumé de N.G., 2008-2009

            L’auteur s’est intéressé aux travaux de monsieur Chi et de ses collaborateurs sur l’ontologie («étude de ce qui est réel et de ce qui ne l’est pas) et les fausses conceptions en sciences. Le modèle qui a été développé pour e…
          • Démonstration de la séquestration du CO2 à l'aide d'olivine et de boissons gazeuses avec des étudiants du secondaire pour étudier les concepts de pH et de conductivité électriqueplugin-autotooltip__default plugin-autotooltip_bigDémonstration de la séquestration du CO2 à l'aide d'olivine et de boissons gazeuses avec des étudiants du secondaire pour étudier les concepts de pH et de conductivité électrique

            Demonstrating CO2 Sequestration Using Olivine and Carbonated Beverages with Secondary School Students To Investigate pH and Electrical Conductivity Concepts Johan A. Linthorst and Johanna van der Wal-Veuger, J. Chem. Educ., 2018, 95 (9), pp 1612–1614 DOI: 10.1021/acs.jchemed.7b00680 résumé de F.G. 2018-2019
          • Construction et caractérisation d'un colorimètre compacte, portable, et à bas coût pour le laboratoire de chimieplugin-autotooltip__default plugin-autotooltip_bigConstruction et caractérisation d'un colorimètre compacte, portable, et à bas coût pour le laboratoire de chimie

            Article Construction and Characterization of a Compact, Portable, Low-Cost Colorimeter for the Chemistry Lab Carrie M. Clippard, William Hughes, Balwant S. Chohan, Danny G. Sykes, J. Chem. Educ., 2016, 93 (7), pp 1241–1248 DOI: 10.1021/acs.jchemed.5b00729 résumé de A.H. 2016-2017
          • Étude des phénomènes de dissolution et de précipitation avec un microscope "Smartphone"plugin-autotooltip__default plugin-autotooltip_bigÉtude des phénomènes de dissolution et de précipitation avec un microscope "Smartphone"

            Article Investigating Dissolution and Precipitation Phenomena with a Smartphone Microscope Gregg J. Lumetta and Edgar Arcia, J. Chem. Educ., 2016, 93 (10), pp 1754–1759 DOI: 10.1021/acs.jchemed.6b00248 résumé de J.D. 2016-2017

            Au cours de leurs études, les élèves peuvent faire des observations macroscopiques au niveau des phénomènes de précipitation et de dissolution, mais n’ont jamais pu observer ces phé…
          • Chimie – Sciences de base – UAA 7 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences de base – UAA 7 – Troisième degré

            Notions de base de chimie organique (alcanes, polymères, alcènes)

            Compétences à développer

            * Evaluer l’importance des substances organiques dans l’environnement quotidien du consommateur responsable
          • Exercices scolaires ("Exos") de chimieplugin-autotooltip__default plugin-autotooltip_bigExercices scolaires ("Exos") de chimie

            Divers exercices de chimie ayant certaines des caractéristiques suivantes :

            * originalité, attractivité * liaison à l'actualité, à un ou des problèmes de société * un intérêt historique, ou sur l'histoire des sciences
          • Enduits à la chauxplugin-autotooltip__default plugin-autotooltip_bigEnduits à la chaux

            * Chaux (matière)

            Enduits "naturels" argile-chaux

            * Déterminer le composition * Quel est le bilan carbone si on suppose utiliser des hydrocarbures fossiles pour la production de la chaux * Comparer au plâtre

            Références

            * fr:Plâtre
          • L'efficacité des exemples résolus par rapport aux exemples erronés, à la résolution de problèmes avec tutorat et à la résolution de problèmes dans des environnements d'apprentissage basés sur ordinateurplugin-autotooltip__default plugin-autotooltip_bigL'efficacité des exemples résolus par rapport aux exemples erronés, à la résolution de problèmes avec tutorat et à la résolution de problèmes dans des environnements d'apprentissage basés sur ordinateur

            The efficiency of worked examples compared to erroneous examples, tutored problem solving, and problem solving in computer-based learning environments Bruce M. McLaren, Tamara van Gog, Craig Ganoe, Michael Karabinos, David Yaron, Computers in Human Behavior Volume 55, Part A, February 2016, Page…
          • Le rôle des laboratoires dans l’apprentissage de la chimieplugin-autotooltip__default plugin-autotooltip_bigLe rôle des laboratoires dans l’apprentissage de la chimie

            The role of the laboratory in the chemistry instruction, M.J.Elliot, K.K.Steward and J.J.Lagowski, J. Chem Ed. Vol. 85 No. 1 January 2008, p 145-149. Résumé de N.S., 2008-2009

            De nos jours peu de professeurs (instructeurs) envisagent de donner un cours de chimie de base sans laboratoire. Aussi, les chimistes académiciens et industriels privilégient beaucoup les laboratoires en complément de la théorie, surtout pour les étudiants prépar…
          • Démonstrations de magnétisme et d'oxydation par la combustion de comprimés de supplément de ferplugin-autotooltip__default plugin-autotooltip_bigDémonstrations de magnétisme et d'oxydation par la combustion de comprimés de supplément de fer

            Article : Demonstrations of Magnetism and Oxidation by Combustion of Iron Supplement Tablets Max J. Palmer, Keri A. Martinez, Mayuresh G. Gadgil, and Dean J. Campbell J. Chem. Educ., 2018, 95 (3), pp 423–427 DOI: 10.1021/acs.jchemed.7b00475 résumé de A.D. 2017-2018
          • Luminolplugin-autotooltip__default plugin-autotooltip_bigLuminol

            Le fer contenu dans des traces de sang (hémoglobine) joue le rôle de catalyseur dans la réaction du luminol avec l'eau oxygénée (peroxyde d'hydrogène), qui dégage alors rapidement l'énergie libérée par la réaction en émettent une lumière bleue. c'est de la chimiluminescence.
          • Fait ou Fiction ? La chimie aide les élèves à déterminer la vraissemblance de situations d'émissions de télévisionplugin-autotooltip__default plugin-autotooltip_bigFait ou Fiction ? La chimie aide les élèves à déterminer la vraissemblance de situations d'émissions de télévision

            Fact or Fiction? General Chemistry Helps Students Determine the Legitimacy of Television Program Situations Mark A. Milanick and Ruth L. Prewitt, J. Chem. Educ., 2013, 90 (7), pp 904–906 DOI: 10.1021/ed300155p Sur base d'un résumé de M.M. 2013-2014
          • teaching:didactiquechimie:start page
            • Aluminimumplugin-autotooltip__default plugin-autotooltip_bigAluminimum

              FIXME : à compléter

              Media

              * Pourquoi s’inquiéter de l’aluminium dans les déodorants et pas dans les vaccins ? * Le carburant du futur sera-t-il une poudre métallique ?, CNRS Le journal, 12/07/2019 * Aluminium et mercure * * *
            • Remplissage d'un sac en plastique avec du dioxyde de carbone: un laboratoire par démarche d'investigation guidéeplugin-autotooltip__default plugin-autotooltip_bigRemplissage d'un sac en plastique avec du dioxyde de carbone: un laboratoire par démarche d'investigation guidée

              Article : Filling a Plastic Bag with Carbon Dioxide: A Student-Designed Guided-Inquiry Lab for Advanced Placement and College Chemistry Courses, Laura M. Lanni, Journal of Chemical Education 2014 91 (9), 1390-1392 DOI: 10.1021/ed400901x résumé de N.D. 2017-2018

              Introduction
            • L'oxydation du Fer : Expérimentation, simulation et analyse dans l'introduction de la chimieplugin-autotooltip__default plugin-autotooltip_bigL'oxydation du Fer : Expérimentation, simulation et analyse dans l'introduction de la chimie

              Article The Oxidation of Iron: Experiment, Simulation, and Analysis in Introductory Chemistry Frederic E. Schubert, J. Chem. Educ., 2015, 92 (3), pp 517–520 DOI: 10.1021/ed5001729 résumé de S.G. 2015-2016

              But

              Le but de cet article est de démontrer l'importance de l'oxydation de fer et confronter des données obtenues par expérimentation et par simulation.
            • Généralités sur le CAPAESplugin-autotooltip__default plugin-autotooltip_bigGénéralités sur le CAPAES

              Le Certificat d'Aptitude Pédagogique Approprié à l'Enseignement Supérieur concerne les enseignants en haute école. Cet emploi est nécessaire pour pouvoir s'y inscrire.

              La Communauté française pour les établissements qu'elle organise et tout pouvoir organisateur poursuivent comme objectif dans l'organisation du CAPAES d'amener les maîtres de formation pratique, les maîtres assistants et les chargés de cours recrutés dans une haute école, qui s'y inscrivent à développer…
            • Chimie – Sciences générales – UAA 5 – Troisième degréplugin-autotooltip__default plugin-autotooltip_bigChimie – Sciences générales – UAA 5 – Troisième degré

              Liaisons chimiques et configuration spatiale des espèces chimiques

              Compétences à développer

              * A partir du modèle de Lewis et d’informations du tableau périodique des éléments, représenter une molécule avec ses liaisons.
            • Images libres en chimieplugin-autotooltip__default plugin-autotooltip_bigImages libres en chimie

              * N'oubliez pas de respecter les licences (sauf domaine public ou licence CC-zero), cf. les explications à la page Ressources éducatives libres. Voir en particulier les sources mentionnées ici : Images libres * Plutôt que de copier l'image, surfez vers le lien afin de sélectionner la résolution qui vous convient
            • Créer et synthétiser des senteurs artificielles en utilisant la chimie des parfums plugin-autotooltip__default plugin-autotooltip_bigCréer et synthétiser des senteurs artificielles en utilisant la chimie des parfums 

              Article Using Flavor Chemistry To Design and Synthesize Artificial Scents and Flavors Jessica L. Epstein, Michael Castaldi, Grishma Patel, Peter Telidecki, and Kevin Karakkatt, J. Chem. Educ., 2015, 92 (5), pp 954–957 DOI: 10.1021/ed500615a résumé de G.D. 2015-2016
            • 5 choses que les chimistes devraient savoir à propos de la littérature de la recherche en éducationplugin-autotooltip__default plugin-autotooltip_big5 choses que les chimistes devraient savoir à propos de la littérature de la recherche en éducation

              Article Five Things Chemists (and Other Science Faculty) Should Know about the Education Research Literature S. Seethaler, J. Chem. Educ., 2016, 93 (1), pp 9–12 DOI: 10.1021/acs.jchemed.5b00109 résumé de M.A. 2016-2017

              Introduction

              De nombreuses études empiriques démontrent la valeur ajoutée de l’apprentissage actif, c’est-à-dire une approche constructive du savoir. Si l’enseignant suit cette…
            • Combinaison de la chimie et de la musique pour augmenter l'intérêt des étudiants. Utilisation des chansons pour accompagner des matières chimiquesplugin-autotooltip__default plugin-autotooltip_bigCombinaison de la chimie et de la musique pour augmenter l'intérêt des étudiants. Utilisation des chansons pour accompagner des matières chimiques

              Combining Chemistry and Music To Engage Student Interest", Using Songs To Accompany Selected Chemical Topics, A.M. Last, J. Chem. Ed. Vol. 86 No. 10 October 2009, pp 1202-1204 - Résumé de L.M., 2009-2010
            • Évaluation de la compréhension des étudiants sur la conception d’équations équilibrées et les proportions stoechiométriques en utilisant des dessinsplugin-autotooltip__default plugin-autotooltip_bigÉvaluation de la compréhension des étudiants sur la conception d’équations équilibrées et les proportions stoechiométriques en utilisant des dessins

              Evaluating Students' Conceptual Understanding of Balanced Equations and Stoichiometric Ratios Using a Particulate Drawing Michael J. Sanger, J. Chem. Educ., 2005, 82 (1), p 131 DOI: 10.1021/ed082p131 Sur base d'un résumé de N. B., AESS 2006-2007. Article d'intérêt didactique.
            • Des équilibres acide-baseplugin-autotooltip__default plugin-autotooltip_bigDes équilibres acide-base

              * Des équilibres acide-base, Partie 1. Les conceptions et les difficultés les plus importantes des étudiants du secondaire - Acid-base Equilibria, Part I. Upper Secondary Students’ Misconceptions and Difficulties, DEMEROUTI M., KOUSATHANA M, TSAPARLIS G., Chemical Educator, 2004, 9, pp 122-131 * Des équilibres acide-base, partie 2. Effets du niveau de développement mental et du style cognitif sur la compréhension conceptuelle et la capacité de résolution des problè…
            • Didactique de la chimieplugin-autotooltip__default plugin-autotooltip_bigDidactique de la chimie

              Cours, exercices et stages :

              * Séminaire de méthodologie spéciale en chimie (agrégation en chimie, 45 H cours et 15 H TP + masters chimie à finalité didactique) * Séminaires de méthodologie spéciale de la chimie (agrégation en biologie, 15 H cours + masters BOE & BBMC à finalité didactique) * Micro-enseignement et analyse des pratiques pédagogiques (20 H) *
            • Qui a inventé l'eau chaudeplugin-autotooltip__default plugin-autotooltip_bigQui a inventé l'eau chaude

              Peut-être un cuisinier ?

              Atelier autour de la calorimétrie dans une cuisine

              Introduction

              La cuisson des aliments permet à l'homme de mieux s'alimenter. L'eau est le milieu le plus largement utilisé pour cuire nos pâtes, légumes, riz, œufs,$m$$c$$T_i$$T_f$$Q = m c (T_f - T_i)$$m$$\Delta H_f$$Q = m \Delta H_f$
            • Expériences et réflexions à propos de l'enseignement de la structure atomique via une classe puzzle dans l'enseignement secondaireplugin-autotooltip__default plugin-autotooltip_bigExpériences et réflexions à propos de l'enseignement de la structure atomique via une classe puzzle dans l'enseignement secondaire

              Experiences and Reflections about Teaching Atomic Structure in a Jigsaw Classroom in Lower Secondary School Chemistry Lessons, Ingo Eilks, J. Chem. Ed. 82(2), pp 313-319,2005. Résumé de A.B. 2010-2011. Article d'intérêt didactique

              Introduction
            • Étude de l'équilibre d’une réaction chimique entre les ions ferriques et les ions iodures en solution aqueuse en utilisant une approche simple et peu coûteuseplugin-autotooltip__default plugin-autotooltip_bigÉtude de l'équilibre d’une réaction chimique entre les ions ferriques et les ions iodures en solution aqueuse en utilisant une approche simple et peu coûteuse

              Article Studying Equilibrium in the Chemical Reaction between Ferric and Iodide Ions in Solution Using a Simple and Inexpensive Approach Pavel Anatolyevich Nikolaychuk and Alyona Olegovna Kuvaeva, J. Chem. Educ., 2016, 93 (7), pp 1267–1269 DOI: 10.1021/acs.jchemed.5b00958
            • Communication scientifique : apprendre aux élèves à préparer et effectuer efficacement des présentations oralesplugin-autotooltip__default plugin-autotooltip_bigCommunication scientifique : apprendre aux élèves à préparer et effectuer efficacement des présentations orales

              Scientific Communication: Teaching Students to Prepare and Deliver Effective Oral Presentations, Lesley Brown, Chem. Educator 2008, 13, 54–58. Résumé de V.D., 2008-2009

              Tous les étudiants en sciences ont besoin de compétences leur permettant d’effectuer des présentations scientifiques orales. Cet exercice apprend aux élèves à chercher l’information, à l’organiser et à la présenter à …
            • Perpectives sur les travaux pratiques dans les études supérieures : objectifs et obstacles à leur efficacitéplugin-autotooltip__default plugin-autotooltip_bigPerpectives sur les travaux pratiques dans les études supérieures : objectifs et obstacles à leur efficacité

              Faculty Perspectives of Undergraduate Chemistry Laboratory: Goals and Obstacles to Success, Laura B. Bruck and Marcy Towns, Journal of Chemical Education, Vol. 87 No. 12, pp 1416-1424 - December 2010. Résumé de M.R., 2010-2011.
            • Comment introduire la notion d’aromaticité chimique ?plugin-autotooltip__default plugin-autotooltip_bigComment introduire la notion d’aromaticité chimique ?

              Discovering Chemical Aromaticity Using Fragrant Plants, T.L. Schneider, J.Chem.Educ. 2010, 87(8), 793-795. Résumé de D.F., 2010-2011

              But de l’activité

              Le but de cette activité est d’étudier la notion d’aromaticité chimique. Pour ce faire, le professeur a voulu mettre en place une situation permettant de relier la chimie organique à la vie quotidienne. Le challenge demandé aux étudiants est de choisir une plante odorante et d’identifier la …
            • HCQ 23 mai 2020plugin-autotooltip__default plugin-autotooltip_bigHCQ 23 mai 2020

              * → fin de partie

              ⛔ Chloroquine à la Marseillaise : fin de partie ! ⛔

              [⚠ Avertissement : ceci est un long article qui ne cherche pas à vous faire croire mais tentera d’expliquer et, en toute fin, de lister des ressources pour aller vérifier par vous-mêmes les données scientifiques et pas celle de Gérard, médecin épidémiologiste depuis 3 jours après formation Doctissimo ⚠]
            • Valence, nombre oxydation et charge formelle : Trois concepts liés mais fondamentalement différentsplugin-autotooltip__default plugin-autotooltip_bigValence, nombre oxydation et charge formelle : Trois concepts liés mais fondamentalement différents

              Valence, Oxidation Number, and Formal Charge: Three Related but Fundamentally Different Concepts De Gerard Parkin, J. Chem Ed. Vol. 83 No. 5 may 2006, pp 791-799) résumé de J.L., 2007-2008

              Les termes de « valence » et d’ « oxydation » apparaissent fréquemment dans les textes à la fois élémentaires mais aussi avancés de la chimie. Cependant, il est évident à partir de la littérature que ces terme…
          • Liens Web diversplugin-autotooltip__default plugin-autotooltip_bigLiens Web divers

            (en recontruction)

            Fournisseurs d'informations générales

            Bibliothèques réelles et virtuelles

            * Gallica, bibliothèque numérique (Bibliothèque Nationale de France) *

            Dictionnaires, encyclopédies

            * Wiktionnaire * Wikipédia

            Médias, éditeurs

            * Le Monde Diplomatique * ...
          • Test de l'extension doodle4plugin-autotooltip__default plugin-autotooltip_bigTest de l'extension doodle4

            Test de l'extension doodle4
          • Physico-chemical hydrodynamicsplugin-autotooltip__default plugin-autotooltip_bigPhysico-chemical hydrodynamics

            English : these works mainly focused on the coupling between thermocapillary and thermogravitational convections. The use of binary alcohol systems presenting unusual dependences of the interfacial or surface tension allowed the study of both positive and negative coupling of the bulk and capillary convections. Some more occasional works have been done on limited studies, like convection implying thermodiffusion (Soret effect), Laser Doppler Velocimetry (LDV), and…
          • Sylvie Colaireplugin-autotooltip__default plugin-autotooltip_bigSylvie Colaire

            * secondaire : AR Mons 2019 * 1er cycle : bac chimie 2022 * 2ème cycle : master FA chimie 2024 * email perso : * email UMONS : * Matricule : 250219 * occupation : non * mobile : 0499 99 11 22 * réside : Mons

            Stage 1
          • iconsplugin-autotooltip__default plugin-autotooltip_bigicons

            Page des icônes utilisés ou utilisables sur le site Références

            Logos sous licences libres :

            * education : * chemistry : * physics : * floss : * numeric :
          • Trèvesplugin-autotooltip__default plugin-autotooltip_bigTrèves

            13 au 15 décembre

            * Berghotel Kockelsberg3,5 étoiles - Kockelsberg 1, Trèves, RP, 54293, Allemagne * * * * * * * parking * * *
          • Diversplugin-autotooltip__default plugin-autotooltip_bigDivers

            * Formulaire de contact, blog : * Le Service de Didactique des Disciplines Scientifiques : (site en construction) * Activités d'enseignement * Chimie-physique * Programmation appliquée à la chimie, méthodes de calcul, et initiation à l'informatique * Didactique de la chimie et autres activités de l'AESS et du CAPAES en Faculté des Sciences * les Unités d’acquis d’apprentissage en chimie dans le secondaire *…
          • testplugin-autotooltip__default plugin-autotooltip_bigtest

            test
          • test d'une tableplugin-autotooltip__default plugin-autotooltip_bigtest d'une table

            tagada COMPÉTENCES Compétences et savoir-faire scientifiques Appréhender une réalité complexe.Faire émerger l'énigme à résoudre : 01. Formuler des questions à partir d'une observation, d'une information, d'un événement,
          • Formulaire d'inscription à un mailingplugin-autotooltip__default plugin-autotooltip_bigFormulaire d'inscription à un mailing

            Pour inscription au mailing. Indiquer commentaires + respect privacy (ref UMONS) ...

            ajouter timestamp, CAPTCHA, référence à une privacy policy, cases à cocher ?
          • test-rssplugin-autotooltip__default plugin-autotooltip_bigLes dernières conférences du cycle des Jeudis du Libre :

            Mediapart :

            Le Monde
          • wiki
            • Création d'un ebookplugin-autotooltip__default plugin-autotooltip_bigCréation d'un ebook

              Dès que vous avez utilisé l'icône de la barre latérale “Ajouter au livre”, vous aurez en tête de chaque page disponible un bandeau vous donnant accès à un créateur de livre. Vous pouvez facilement ajouter ou enlever toute page (comme avec l'icône du bandeau latéral), vous rendre vers le gestionnaire pour
            • Formatting Syntaxplugin-autotooltip__default plugin-autotooltip_bigFormatting Syntax

              DokuWiki supports some simple markup language, which tries to make the datafiles to be as readable as possible. This page contains all possible syntax you may use when editing the pages. Simply have a look at the source of this page by pressing
            • Welcome to your new DokuWikiplugin-autotooltip__default plugin-autotooltip_bigWelcome to your new DokuWiki

              Congratulations, your wiki is now up and running. Here are a few more tips to get you started.

              Enjoy your work with DokuWiki,

              -- the developers

              Create your first pages

              Your wiki needs to have a start page. As long as it doesn't exist, this link will be red:
            • ebookplugin-autotooltip__default
            • DokuWikiplugin-autotooltip__default plugin-autotooltip_bigDokuWiki

              wiki:dokuwiki DokuWiki is a simple to use and highly versatile Open Source wiki software that doesn't require a database. It is loved by users for its clean and readable syntax. The ease of maintenance, backup and integration makes it an administrator's favorite. Built in
          • playground
            • PlayGroundplugin-autotooltip__default plugin-autotooltip_bigPlayGround

              j'essaye !

              *
          • Applied numerical analysis, digital image processingplugin-autotooltip__default plugin-autotooltip_bigApplied numerical analysis, digital image processing

            English : these works are mainly concerned by applied numerical analysis to signal and image processing problems occuring in physical chemistry.

            Français : Mes travaux dans le domaine de l’informatique concernent principalement le développement et l’implémentation de méthodes d’analyse numérique, de traitement du signal, de l’image en vue d’applications en chimie-physique (modélisation, simulation, traitement de données expérimentales).…
          • Certificat Universitaire "CUILL"
            • Logiciels libresplugin-autotooltip__default
              • Unisonplugin-autotooltip__default plugin-autotooltip_bigUnison

                Logiciel de synchronisation de fichiers, doté également de fonctionnalités lui permettant de créer et gérer des sauvegardes de répertoires. La synchronisation est bidirectionnelle : les modifications de chacun des répertoires sont reportées sur l'autre, la modification la plus récente étant considérée comme la bonne. Il permet donc de garder à niveau des répertoires se trouvant en même temps sur deux machines différentes.
              • Ubuntuplugin-autotooltip__default plugin-autotooltip_bigUbuntu

                Ceci est une page en construction destinée à faire partager mon expérience personnelle de Ubuntu, une distribution très populaire de Linux !

                Liens principaux

                * , le site officiel * site francophone non officiel * (site des utilisateurs francophones et
              • Configuration d'un ancien portable 32 bits en serveur Debianplugin-autotooltip__default plugin-autotooltip_bigConfiguration d'un ancien portable 32 bits en serveur Debian

                * portable Fujitsu-Siemens Amilo P 1536 (2006) lien 1 * processeur 32 bits dual core * carte graphique au format MXM (mal supporté sous les dernières versions de distributions GNU/Linux) (ubuntu 14.04 est la dernière déclinaison fonctionnelle)
              • Etudier et s'autoévaluer en vue de de la certification LPIC-1plugin-autotooltip__default plugin-autotooltip_bigEtudier et s'autoévaluer en vue de de la certification LPIC-1

                Document en construction ! (document de travail à usage interne : lpic-1)

                Définition de la certification LPIC

                Lectures :

                * Linux Professional Institute et les certifications LPIC (5 minutes) * a

                Cursus LPI 1 - préparation à l'examen 101 : Bases de l'administration système
              • Convertir en mode monochrome compressé un fichier PDFplugin-autotooltip__default plugin-autotooltip_bigConvertir en mode monochrome compressé un fichier PDF

                Un fichier scanné en niveaux de gris (voire couleurs) de feuilles manuscrites génère un fichier PDF particulièrement gourmand en taille, avec souvent de l'ordre de 5 Mo par page ! Il est donc très intéressant d'archiver un tel document dans une version compressée monochrome.
              • Message d'erreur sur une clé ou un disque externe : "Erreur lors de la copie vers ... La destination est en lecture seule"plugin-autotooltip__default plugin-autotooltip_bigMessage d'erreur sur une clé ou un disque externe : "Erreur lors de la copie vers ... La destination est en lecture seule"

                En construction. Pages :

                * ?? * ? * ?? (scan disk sous win$...)
              • Mot de passe perduplugin-autotooltip__default plugin-autotooltip_bigMot de passe perdu

                Si vous avez un accès physique à l'ordinateur et que le disque n'est pas chiffré, c'est réalisable

                * Mot de passe root perdu ? Voici comment récupérer un accès à votre Linux * ou aller éditer le fichier /etc/shadow à partir d'un live-CD (ou en extrayant la carte pour un Raspberry Pi) * Une fois un mot de passe éventuellement provisoire remis, on peut le modifier via la commande
              • Configuration type d'un serveur sous Ubuntu 16.04 Xenial Xerusplugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un serveur sous Ubuntu 16.04 Xenial Xerus

                * 09/07/2020 Ubuntu server 16.04.6 Xenial Xerus (Long Term Support) : * références, tutoriels,... * How to Install Ubuntu Server on VirtualBox 11 Dec 2019, James Hibbard * * * Installation Apache Mysql PHP phpmyadmin
              • Quelques lignes de commandes fréquemment utilisablesplugin-autotooltip__default plugin-autotooltip_bigQuelques lignes de commandes fréquemment utilisables

                Copie de fichiers

                * copier un fichier vers une destination (par exemple serveur web), avec droits -rw-r--r-- : sudo cp fichier.mpg /var/www/html

                * Copier un répertoire récursivement en préservant droits et propriétaires (cf.
              • À propos de Java sous Linuxplugin-autotooltip__default plugin-autotooltip_bigÀ propos de Java sous Linux

                * How can I tell what version of Java I have installed? * * * * ...
              • BorgBackupplugin-autotooltip__default plugin-autotooltip_bigBorgBackup

                * BorgBackup – Deduplicating archiver with compression and authenticated encryption * Attic (backup software) - Wikipedia (forked → Borg) * GitHub - borgbackup/borg: Deduplicating archiver with compression and authenticated encryption. * Quick Start — Borg - Deduplicating Archiver 1.1.13 documentation * BorgBase - Secure hosting for your BorgBackup Repos * GitHub - borgbase/vorta: Desktop Backup Client for Borg
              • XP-Pen Artistplugin-autotooltip__default plugin-autotooltip_bigXP-Pen Artist

                * Tests et tutoriel basés sur le modèle Artist 13.3 Pro

                utilisation sous Ubuntu

                * août 2020 : * télécharger Linux_Pentablet_V1.2.13.1.tar.gz(20200428) Apr 28,2020 PM 12:07 * extraire dans un répertoire (i.e. ~/Téléchargements/Linux_Pentablet_V1.2.13.1 * autoriser l'exécution du fichier Pentablet_Driver.sh
              • Convertir des fichiers pnm en pdfplugin-autotooltip__default plugin-autotooltip_bigConvertir des fichiers pnm en pdf

                * sudo apt-get install graphicsmagick

                ??
              • Configurer un Raspberry Pi 3 sous Raspbian avec l'interface graphique XFCEplugin-autotooltip__default plugin-autotooltip_bigConfigurer un Raspberry Pi 3 sous Raspbian avec l'interface graphique XFCE

                Utilisation comme poste de travail, d'apprentissage de GNU/Linux et de la programmation.

                Matériel nécessaire :

                * un Raspberry Pi version 3, avec une alimentation * clavier, souris USB *
              • LaTeX : quelques références et astuces pour son utilisationplugin-autotooltip__default plugin-autotooltip_bigLaTeX : quelques références et astuces pour son utilisation

                TeX est un langage de composition typographique adapté à la production de documents techniques, scientifiques et mathématiques de grande qualité typographique. Il permet également de produire toutes sortes d'autres documents, qu'il s'agisse de simples lettres ou de livres entiers. LaTeX est un regroupement de macros qui utilisent TeX comme outil de mise en page. TeX et LaTeX sont des logiciels libres et gratuits. LaTeX a été initiale…
              • Page testplugin-autotooltip__default plugin-autotooltip_bigPage test

                * secure_shell
              • Sauvegarder des ressources en réseau via l'interface graphique grsyncplugin-autotooltip__default plugin-autotooltip_bigSauvegarder des ressources en réseau via l'interface graphique grsync

                Installer grsync

                * via la logithèque * via synaptic * via la commande sudo apt-get install grsync

                Sauvegarde de partages réseau

                Rendre visible un voisinage réseau sous la forme d'un point de montage :
              • Configuration type d'un serveur sous Ubuntuplugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un serveur sous Ubuntu

                * Configuration pour usage général et scientifique * Téléchargement : , dernière version : Ubuntu Server 20.04 LTS Focal Fossa, architecture AMD64 (03/07/2020) * Gravure du fichier iso, ou préparation d'une clé USB via Balena-Etcher (par exemple)
              • Linuxplugin-autotooltip__default plugin-autotooltip_bigLinux

                * Raspberry Pi * Configuration type d'un PC sous Xubuntu, 20.04 Focal Fossa * Configuration type d'un PC sous Ubuntu * Configuration type d'un serveur sous Ubuntu, 18.04 Bionic Beaver (19.10 Eoan Ermine testé) * Configuration d'un ancien portable 32 bits en serveur Debian, 10.3.0-i386 Buster (version stable de 2019)

                Trucs et astuces

                * Fusionner des images en un seul fichier PDF (Merge images into one PDF file) * Quelques lignes de commandes fréquemment utilisables * Mess…
              • Références spécifiques concernant R et Pythonplugin-autotooltip__default plugin-autotooltip_bigRéférences spécifiques concernant R et Python

                * Rpy2

                Références générales sur R

                * R, site web officiel * Comprehensive R archive network * An Introduction to R * Rstudio, éditeur spécialisé pour R * rOpenSci

                Dans les media

                * Programming tools: Adventures with R, Article Nature janvier 2015
              • Configurer un Raspberry Pi 3 sous Ubuntu serverplugin-autotooltip__default plugin-autotooltip_bigConfigurer un Raspberry Pi 3 sous Ubuntu server

                * Raspberry Pi * Raspberry Pi * * * * Installing operating system images (cf. balenaEtcher, a graphical SD card writing tool) * Ubuntu Server on a Raspberry Pi 2, 3 or 4 * Documentation Ubuntu * Installing Ubuntu Server to the Raspberry Pi, en particulier, “Setting up SSH for Ubuntu Server”, si ce n'est pas fonctionnel par défaut …
              • OBS Studioplugin-autotooltip__default plugin-autotooltip_bigOBS Studio

                Logiciel libre et open source d'enregistrement vidéo et de streaming en direct

                * OBS Studio * site officiel * : guide, documentation

                * Tutoriels vidéos sur Youtube * COMMENT UTILISER OBS ? (Les bases), juin 2017 * LEARN OBS IN 30 MINUTES | Complete Tutorial for Beginners 2019 * Multi-track Recording On Linux With OBS

                Autres logiciels utiles :

                * OpenShot, pour montage ultérieur (découpes,
              • Configurer un Raspberry Pi 2 sous Raspbian avec l'interface graphique XFCEplugin-autotooltip__default plugin-autotooltip_bigConfigurer un Raspberry Pi 2 sous Raspbian avec l'interface graphique XFCE

                Utilisation comme poste de travail, d'apprentissage de GNU/Linux et de la programmation.

                Matériel nécessaire :

                * un Raspberry Pi version 2, avec une alimentation * clavier, souris USB
              • Configuration type d'un serveur sous Ubuntu 18.04 Bionic Beaverplugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un serveur sous Ubuntu 18.04 Bionic Beaver

                * 06/01/2020 Ubuntu server 19.10 Eoan Ermine : : 64-bit PC (AMD64) server install image (utile pour l'intérêt des nouveautés, avec possibilité de mise à jour proche vers la 20.04 LTS) * 09/07/2020 Ubuntu server 18.04.4 Bionic Beaver (
              • Fusionner des images en un seul fichier PDF (Merge images into one PDF file)plugin-autotooltip__default plugin-autotooltip_bigFusionner des images en un seul fichier PDF (Merge images into one PDF file)

                Premièrement, il faut convertir les images en des fichiers monochromes. Cela peut se faire à l'aide par exemple de i.e. Gwenview, en deux étapes de traitement par lôt (conversion jpg
              • Applications portables (Windows)plugin-autotooltip__default plugin-autotooltip_bigApplications portables (Windows)

                Cette rubrique montre la possibilité d'utiliser des Logiciels Libres (ou simplement gratuits) pour Windows, placés sur des supports USB (clé ou disque), afin de faciliter leur usage par des utilisateurs nomades, ou ne disposant pas des droits d'administration (étudiants en salle de PCs,
              • Installation d'un serveur LAMPplugin-autotooltip__default plugin-autotooltip_bigInstallation d'un serveur LAMP

                Le serveur sera installé dans une machine virtuelle (invitée) sous VirtualBox, avec la configuration de deux CMS (Wordpress et Dokuwiki) et d'outils pour la gestion de groupes de personnes ayant différents rôles :
              • Ajout de texte et de filigrane (watermark) à un fichier pdfplugin-autotooltip__default plugin-autotooltip_bigAjout de texte et de filigrane (watermark) à un fichier pdf

                Références

                * Imagemagick : * *

                * Jpftweak : * *

                * Writer (LibreOffice) *
              • FreeBSD (& PC-BSD)plugin-autotooltip__default plugin-autotooltip_bigFreeBSD (& PC-BSD)

                Page en construction, en fonction de l'expérience acquise par la mise en place d'un serveur freenas (Network Attached Storage libre).
              • Utilisation d'une tablette graphique Wacomplugin-autotooltip__default plugin-autotooltip_bigUtilisation d'une tablette graphique Wacom

                * *

                * Prise en charge des tablettes graphiques sous Ubuntu * modèles testés : * Wacom Bamboo Fun medium * Wacom Intuos M CTL-6100WL

                * Tablettes graphiques Wacom * Linux Wacom project - * (+ wiki)

                *

                * ATTE…
              • Audacityplugin-autotooltip__default plugin-autotooltip_bigAudacity

                * liens * * FAQ:Recording - How To's - Can I record from two microphones (or two audio interfaces) at the same time? * Audacity : Réaliser une bande sonore, avec voix, sans parasite du micro, pour annonce téléphonique ! * Tutorial - Recording Computer Playback on Linux (PulseAudio, Jack) *

                * podcast (conseils, matériel,...) *
              • Python : quelques références, trucs et astucesplugin-autotooltip__default plugin-autotooltip_bigPython : quelques références, trucs et astuces

                Python est un langage de programmation de haut niveau, libre, polyvalent, facilement accessible aux débutants, mais permettant aussi de réaliser des applications sophistiquées et professionnelles. Certains l'utilisent simplement comme langage de script, pour automatiser et faciliter différentes tâches informatiques.
                • Sélection de codes Python du site ActiveStateplugin-autotooltip__default plugin-autotooltip_bigSélection de codes Python du site ActiveState

                  Site :

                  * Draw Text To Image * Mandelbrot Fractal image output to ppm file * Find Duplicate Files * Teach your computer a few tricks (Artificial Neural Network) * Game of Life - Python 3.4 & tkinter * 2D Fluid Simulation using FHP LGCA (Lattice Gas Cellular Automata) * Simple Linear Regression with Pure Python * All in one Area Calculator (tkinter & Python 3) * Rotatable Tetrahedr…
                • Tutoriel sur Cairo pour les programmeurs Pythonplugin-autotooltip__default plugin-autotooltip_bigTutoriel sur Cairo pour les programmeurs Python

                  Texte original en anglais de Michael Urman.

                  Cairo est une puissante bibliothèque graphique 2D.

                  Ce document vous présente la façon dont fonctionne Cairo et la plupart des fonctions que vous utiliserez pour créer le graphisme que vous désirez.
                • Quelques codes astucieuxplugin-autotooltip__default plugin-autotooltip_bigQuelques codes astucieux

                  N.B. : codes glanés sur des forums, canaux IRC, mailing lists, ... (et parfois créés). Les codes de cette page sont normalement pythoniques, et à considérer sous licence cc0, sauf mention contraire.

                  Effacer les lignes vides dans un fichier
                • Questions fréquentesplugin-autotooltip__default plugin-autotooltip_bigQuestions fréquentes

                  FIXME : ...

                  * How to print in Python without newline or space?
                • Installer facilement des modules pythonplugin-autotooltip__default plugin-autotooltip_bigInstaller facilement des modules python

                  AnacaondaPythonxy ...

                  Introduction

                  Des modules additionnels de Python peuvent être installés via des sites qui les proposent. Il s'agit de :

                  * créateurs de programmes, librairies * firmes ou associations qui proposent des ensembles cohérents (comme
              • Répertoires de logiciels libresplugin-autotooltip__default plugin-autotooltip_bigRépertoires de logiciels libres

                Site généraliste : Framasoft

                A suivre...

                * Freeplane, mind mapping * Sozi, presentations
              • Configurer un Raspberry Pi 2 sous Ubuntu avec l'interface graphique MATEplugin-autotooltip__default plugin-autotooltip_bigConfigurer un Raspberry Pi 2 sous Ubuntu avec l'interface graphique MATE

                Utilisation comme poste de travail, d'apprentissage de GNU/Linux et de la programmation.

                Téléchargement et préparation de la carte microSD

                * Matériel nécessaire : *
              • Configurer un Raspberry Pi 3 sous Ubuntu avec l'interface graphique MATEplugin-autotooltip__default plugin-autotooltip_bigConfigurer un Raspberry Pi 3 sous Ubuntu avec l'interface graphique MATE

                Utilisation comme poste de travail, d'apprentissage de GNU/Linux et de la programmation.

                Matériel nécessaire :

                * un Raspberry Pi version 3, avec une alimentation * clavier, souris USB * connexion filaire à internet
              • Logiciels et formats libres en chimieplugin-autotooltip__default plugin-autotooltip_bigLogiciels et formats libres en chimie

                (en construction)

                Logiciels d'écritures de formules chimiques

                Lorsqu'on veut créer des documents dans le domaine de la chimie, on a inévitablement à écrire des formules chimiques, développées, semi-développées, compactes,
              • Configuration type d'un PC sous Xubuntu 18.04, Bionic Beaverplugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un PC sous Xubuntu 18.04, Bionic Beaver

                * Configuration pour usage général et scientifique * Téléchargement : , dernière version : Xubuntu 18.04.1 LTS Bionic Beaver, AMD64 Desktop * Gravure du fichier iso * Version précédente :
              • Informations hardware, tests et performancesplugin-autotooltip__default plugin-autotooltip_bigInformations hardware, tests et performances

                dmidecode

                sudo dmidecode

                inxi

                * si nécessaire : sudo apt-get install inxi * basic hardware information : sudo inxi -bxx * sudo inxi -Frmxx * man inxi

                Références

                *
              • Mettre automatiquement au repos un disqueplugin-autotooltip__default plugin-autotooltip_bigMettre automatiquement au repos un disque

                Il s'agit d'utiliser la commande hdparm de manière automatique à la fin de la séquence de boot : hdparm -S 240 /dev/sda ajouté dans le fichier /etc/rc.local provoquera le stand-by du disque après 20 minutes d'inactivités.
              • Ressources éducatives libresplugin-autotooltip__default plugin-autotooltip_bigRessources éducatives libres

                Cette page répertorie des ressources libres, au sens du domaine public ou des licences de type Creative Commons CC-BY-SA, CC-BY, ou CC-Zero, compatibles par exemple avec Wikipedia (qui est sous licence CC-BY-SA).

                Précision sur la notion de libre, opensource, ouvert(ure)
              • DokuWikiplugin-autotooltip__default plugin-autotooltip_bigDokuWiki

                * Présentations : * DokuWiki, un wiki "One size fits all" : conférence JDL du 20 février 2020 * Présentation JDL du 20 février 2020 (slideshow) * rss (test-rss) * tables (test-table) * Extensions

                * Dokuwiki, un wiki polyvalent et efficace aux nombreuses fonctionnalités

                * fr:DokuWiki : sur wikipédia * DokuWiki : sur wikipedia en anglais * : site web officiel * : gitHub reposit…
              • SSH, secure shell tunnelling et autres trucs et astucesplugin-autotooltip__default plugin-autotooltip_bigSSH, secure shell tunnelling et autres trucs et astuces

                Téléchargement sur A d'un fichier chez C via une machine B

                “exercice” SSH pour résoudre ceci : d'une machine A (à la maison par exemple) télécharger un fichier sur une serveur public C (site.com) qui n'autorise l'accès que via une machine B (door.com chez l'employeur par exemple) reconnue. A a un accès SSH à B avec des clés présentes.
              • DokuWiki, un wiki "One size fits all"plugin-autotooltip__default plugin-autotooltip_bigDokuWiki, un wiki "One size fits all"

                Conférence JDL du 20 février 2020

                Pour tout le monde, le mot wiki fait référence à l'encyclopédie en ligne Wikipedia. Plus généralement, un wiki est un système de gestion de contenu permettant de créer, modifier et présenter des informations dans de nombreuses pages reliées entre elles par des liens hypertextes. L'édition est souvent collaborative, utilise un langage de balises simplifié, et le logiciel dédié assure l'indexation du contenu, les recherches,…
              • Si vous voulez mettre fin aux jours de votre OS Linux...plugin-autotooltip__default plugin-autotooltip_bigSi vous voulez mettre fin aux jours de votre OS Linux...

                voici quelques lignes de codes particulièrement agressives pour votre système ! Certaines sont plus irrécupérables que d'autres. L'objectif est de les étudeir, les comprendre, pas les exécuter
              • KDE Connectplugin-autotooltip__default plugin-autotooltip_bigKDE Connect

                * Présentation : * Documentation : ou *

                Astuces

                * si utilisation sous xfce, le gestionnaire de fichiers Dolphin de plasma doit être utilisé pour pouvoir voir le device et y envoyer des fichiers *

                Problèmes divers
              • Configuration type d'un PC sous Xubuntuplugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un PC sous Xubuntu

                * Configuration pour usage général et scientifique * Téléchargement : , dernière version : Xubuntu 20.04 LTS Focal Fossa, AMD64 Desktop * Gravure du fichier iso * Versions précédentes : * Configuration type d'un PC sous Xubuntu 18.04, Bionic Beaver
              • Etudier et s'autoévaluer en vue d'obtenir le "Linux Essentials Certificate of Achievement"plugin-autotooltip__default plugin-autotooltip_bigEtudier et s'autoévaluer en vue d'obtenir le "Linux Essentials Certificate of Achievement"

                Document en construction ! (document de travail à usage interne : lpi_linux_essential)

                Le document proposé sur ces pages est également disponible sur le wiki de l'ASBL LoLiGrUB, et bénéficie de l'apport d'autres auteurs membres de l'ASBL (Thierry G.,
              • Un peu d'humour via GNU/Linuxplugin-autotooltip__default plugin-autotooltip_bigUn peu d'humour via GNU/Linux

                En ligne de commande

                Un bonjour avec une ascii image sympa :

                echo Bonjour $USER, nous sommes le `date +"%A %e %B %Y"`, et il est : `date +"%H"` h `date +"%M"` | cowsay -f $(/bin/ls /usr/share/cowsay/cows -1 | head -n $(expr $$$(date +%s) % $(ls /usr/share/cowsay/cows | wc -w) + 1) | tail -n 1)
              • Raspberry Piplugin-autotooltip__default plugin-autotooltip_bigRaspberry Pi

                * Raspberry Pi * Raspberry Pi * * * * Installateur standard noobs : * * software setup guide

                * raspbian * Installing operating system images (cf. balenaEtcher, a graphical SD card writing tool) * balenaEtcher Debian/Ubuntu repository

                * anciennes images :
              • testplugin-autotooltip__default plugin-autotooltip_bigtest

                test
              • Configurer un Raspberry Pi 1 sous Raspbian lite (server)plugin-autotooltip__default plugin-autotooltip_bigConfigurer un Raspberry Pi 1 sous Raspbian lite (server)

                L'objectif est de récupérer des Raspberry Pi 1 Model B (revision 1.2) existants pour les recycler en serveur :

                * 512 MB * 2 ports USB2 * réseau par cable (RJ45) * ARMv6 32 bits *
              • dokuwiki-presentation-jdl-20200220plugin-autotooltip__default plugin-autotooltip_bigDidier Villers (UMONS & ASBL LoLiGrUB)



                20 février 2020, conférence “Jeudis du Libre”

                * pas de connaissance php * pas consultant DokuWiki * utilisateur depuis près de 10 ans

                * Système de gestion de contenu (Content Management System, CMS) * Wiki : création, modification et présentation (web)
              • Bluetooth - astuces diversesplugin-autotooltip__default plugin-autotooltip_bigBluetooth - astuces diverses

                * Profils audio (casques, enceintes connectées,...) : * HSP (Headset Profile ou Profil casque) : offre les fonctionnalités de base pour établir la communication entre un combiné (le téléphone portable) et un casque.
              • Logiciels libres diversplugin-autotooltip__default plugin-autotooltip_bigLogiciels libres divers

                FIXME (en construction)

                Multimedia : images, sons et vidéos

                * OBS Studio Logiciel libre et open source d'enregistrement vidéo et de streaming en direct * Audacity et conseils pour podcast,...

                Utilitaires

                * jrnl is a simple journal application for your command line. Requires pip so first run
              • Bureau à distance sous GNU/Linuxplugin-autotooltip__default plugin-autotooltip_bigBureau à distance sous GNU/Linux

                * bureau_a_distance - Wiki ubuntu-fr * TeamViewer (Teamviewer est une solution propriétaire !) * TeamViewer – Télé-assistance, accès à distance, Servicedesk, réunions et collaboration en ligne * Comment installer TeamViewer sur Ubuntu ? * Utilisation de TeamViewer : Tout ce que vous devez savoir | TeamViewer * How to install TeamViewer on Linux without graphical user interface * How to Install TeamViewer on Ubuntu 20.04 LTS (using command line or G…
              • Configuration type d'un PC sous Ubuntuplugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un PC sous Ubuntu

                Présentation générale de Ubuntu :

                Configuration pour usage général et scientifique.

                Ubuntu 16.04.1 LTS (i386 ou AMD64) Xenial Xerus

                *

                à suivre...

                Ubuntu 14.04 LTS (i386 ou AMD64) Trusty Tahr

              • Configuration type d'un PC sous Xubuntu 16.04plugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un PC sous Xubuntu 16.04

                * Configuration pour usage général et scientifique * Téléchargement : , dernière version : Xubuntu 16.04.2 LTS Xenial Xerus, AMD64 Desktop * Gravure du fichier iso

                Installation

                * Bios/UEFI
              • Configurer un Raspberry Pi 3 sous Ubuntu serverplugin-autotooltip__default plugin-autotooltip_bigConfigurer un Raspberry Pi 3 sous Ubuntu server

                * Raspberry Pi * Raspberry Pi * * * * Installing operating system images (cf. balenaEtcher, a graphical SD card writing tool) * Ubuntu Server on a Raspberry Pi 2, 3 or 4 * Documentation Ubuntu * Installing Ubuntu Server to the Raspberry Pi, en particulier, “Setting up SSH for Ubuntu Server”, si ce n'est pas fonctionnel par défaut …
            • Mapathon à l'UMONS le 25 mars 2020plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 25 mars 2020

              FIXME : page pour l'édition 2020 en construction !!

              Liens rapides :

              * Présentation introductive générale du Mapathon 2020 * Les instructions pour faire de la carto humanitaire libre "HOT OSM" (source) * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule
            • Tableau testplugin-autotooltip__default plugin-autotooltip_bigTableau test

              Colonne1 Colonne 2 Colonne 3 valeur tagadapouet pouet valeur tagadapouet pouet
            • Pages à accès restreint à Didier Villers
              • startold2plugin-autotooltip__default plugin-autotooltip_big* Formulaire de contact DIDACTIQUE [DIDACTIQUE] ET FORMATIONS UMONS
              • Mapathon à l'UMONS le 24 mars 2018plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 24 mars 2018

                Liens rapides :

                * Présentation introductive générale du Mapathon du 24 mars 2018 ! * Les instructions pour faire de la carto humanitaire libre "HOT OSM" * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site * Tasking manager HOT (identifiez vous) * Choisissez un morceau de territoire à cartographier !
              • Vote 451217plugin-autotooltip__default plugin-autotooltip_bigVote 451217

                Vote 451217
              • Intranet du wiki
                • startnewplugin-autotooltip__default plugin-autotooltip_bigDIDACTIQUE ET FORMATIONS UMONS [DIDACTIQUE ET FORMATIONS UMONS]

                  Service de Didactique des Disciplines Scientifiques

                  Agrégation et masters didactiques CAPAES

                  Ecole de Formation des Enseignants

                  CHIMIE-PHYSIQUE (enseignements) [CHIMIE-PHYSIQUE (enseignements)] [CHIMIE-PHYSIQUE (enseignements)]

                  • Enseignements

                  • PhysicoChimie I

                  • Thermodynamique statistique (exercices)

                  • Publications intéressantes

                  • Applications intéressantes

                  NUMÉRIQUE (enseignements) [NUMÉRIQUE (enseignements…
                • Groupe de travail transition secondaire-supérieur en sciences
                  • Opinions et points de vue diversplugin-autotooltip__default
                    • Changement climatiqueplugin-autotooltip__default plugin-autotooltip_bigChangement climatique

                      De mes lectures, discussions, analyses,... je ressors convaincu de la réalité des modifications climatiques globales causées par des facteurs anthropiques. Les effets sont parfois en sens opposés, mais n'en demeurent pas moins inquiétants.
                    • Rôles des Universitésplugin-autotooltip__default plugin-autotooltip_bigRôles des Universités

                      À mon sens, les Universités sont le lieu où on construit et partage les connaissances au meilleur niveau, au profit de l'Université et de la société. De là découlent les impératifs de recherche fondamentale et d'enseignement, la notion de servie à la société, et la nécessité de pratiquer aussi (mais pas exclusivement) la recherche appliquée, la formation professionnalisante.
                  • installation_dokuwikiplugin-autotooltip__default plugin-autotooltip_big* Installation par le CI d'un serveur virtuel Ubuntu * mise à jour, et installation de clés SSH * Installation du serveur : * LAMP : sudo apt-get install apache2 php5 mysql-server libapache2-mod-php5 php5-mysql * mot de passe superutilisateur root mysql : mdp001
                  • Mapathon à l'UMONS le 27 mars 2019plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 27 mars 2019

                    Liens rapides :

                    * Présentation introductive générale du Mapathon 2019 * Les instructions pour faire de la carto humanitaire libre "HOT OSM" (source) * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site *
                  • startplugin-autotooltip__default
                    • La libre, dimanche 5 mai 2013plugin-autotooltip__default plugin-autotooltip_bigLa libre, dimanche 5 mai 2013

                      Explosion à Schellebelle: le rail est-il sûr ?

                      Que se serait-il passé si l'accident s'était produit non pas dans une zone peu habitée, mais un peu plus loin, à la périphérie de la grande ville Gand, destination du train?

                      L'accident de train transportant des produits toxiques, qui aurait pu se transformer en catastrophe au lourd bilan samedi en Belgique, relance la question de la sécurité du rail en Europe.
                    • testplugin-autotooltip__default plugin-autotooltip_big" (a)"

                      * How face masks have helped slow down the spread of coronavirus in Germany The Local (DE), 09/07/2020
                    • test2plugin-autotooltip__default plugin-autotooltip_big*
                    • test6plugin-autotooltip__default plugin-autotooltip_bigCluster of coronavirus disease 2019 (Covid-19) in the French Alps, 2020
                    • testplugin-autotooltip__default plugin-autotooltip_bigtest

                      test
                    • Le Soir : lundi 6 mai 2013plugin-autotooltip__default plugin-autotooltip_bigLe Soir : lundi 6 mai 2013

                      Les produits toxiques éliminés des égouts de Schellebelle

                      Le nettoyage des égouts a permis d’éliminer les résidus de produits nocifs. Le retour accompagné des riverains évacués à Schellebelle (Wetteren) devrait commencer dans le courant de la journée.

                      Le nettoyage des égouts afin d’éliminer les résidus de produits nocifs a porté ses fruits. «Les mesures effectuées vont dans le bon sens», a indiqué le centre de crise.
                    • La sonde Rosetta a reniflé de l’oxygène sur la comète Tchouriplugin-autotooltip__default plugin-autotooltip_bigLa sonde Rosetta a reniflé de l’oxygène sur la comète Tchouri

                      * Le monde, 28/10/2015 (utilisation dans des cours abordant les liaisons chimiques, l'ozone, les formules de Lewis,...) * Rosetta sniffs oxygen around comet 67P, Nature 526, 678–681 (29 October 2015) & article

                      Scandale chez Volkswagen

                      *
                  • Polymer physical chemistryplugin-autotooltip__default plugin-autotooltip_bigPolymer physical chemistry

                    English : these works are concerned with structure, morphology and crystallization of semi-crystalline polymers as molecular complexes of poly(oxy ethylene), poly aryl ether ketones, aliphatic polyesters and block copolymers.
                  • dokuwiki_presentation_20170515plugin-autotooltip__default plugin-autotooltip_big* CMS (content management system) * Wiki : création, modification et illustration collaboratives de pages web * syntaxe simple, langage de balisage aisé, extensible * Travail en équipe (collègues, étudiants,...) * Contrôle des accès :
                  • La révolution numériqueplugin-autotooltip__default plugin-autotooltip_bigLa révolution numérique

                    Présentation donnée lors de la conférence “La révolution numérique : entre mythes et réalités”, donnée le 29/02/2016, dans le cadre du cycle Révolutions (conférences organisées par l'extension de l'Université de Mons).

                    Liens complémentaires

                    * La Pascaline *
                  • L’inspection de biologie, chimie, mathématique et physique dans le secondaire du degré supérieurplugin-autotooltip__default plugin-autotooltip_bigL’inspection de biologie, chimie, mathématique et physique dans le secondaire du degré supérieur

                    Exposé de l'inspection en sciences, UMONS, 19 décembre 2011, par :

                    * Nicole Lambelin (Mathématique) * Martine Schellings (biologie/chimie)
                  • Colloque Lémery et expérience du volcan de Lémery
                    • Films, surfaces et interfacesplugin-autotooltip__default plugin-autotooltip_bigFilms, surfaces et interfaces

                      English : physical chemistry, hydrodynamical and mechanical interfacial properties

                      Français : Physicochimie, propriétés mécaniques et hydrodynamique interfaciale

                      Publications

                      * How the geometry controls the tearing of adhesive thin films on curved surfaces. O. Kruglova, F. Brau, D. Villers & P. Damman, Physical Review Letters 107, 164303 (2011).

                    Ce site web utilise des cookies pour analyser le trafic de visites. En restant sur ce site, vous acceptez le stockage de cookies sur votre ordinateur. En savoir plus
                    • teaching/ressourceschimie.txt
                    • Dernière modification: 2020/09/29 10:40
                    • de villersd