Table des matières
Bioinformatique
Manipulations de séquences ADN, ARN, protéines,…
Consulter les références proposées en fin de page !
Compter les nucléotides d'une séquence ADN
- Counting_DNA_Nucleotides-01.py
#!/usr/bin/env python # -*- coding: utf-8 -*- """ On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T') Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases """ adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" # utilisation d'une liste et de la méthode .count() bases = ["A","C","G","T"] for base in bases: print(adn.count(base),) print() # Variante : for c in 'ACGT': print(adn.count(c),) print() # variante un peu moins lisible out = [] for c in 'ACGT': out.append(str(adn.count(c))) print(' '.join(out)) # utilisation de la technique "list comprehension" count = [adn.count(c) for c in 'ACGT'] for val in count: print(val,) print() # autre "list comprehension", avec impression formatée → version "one line" print("%d %d %d %d" % tuple([adn.count(X) for X in "ACGT"])) # count "à la main", sans utilisation de fonctions/librairie ACGT = "ACGT" count = [0,0,0,0] for c in adn: for i in range(len(ACGT)): if c == ACGT[i]: count[i] +=1 for val in count: print(val,) print() # count "à la main", avec .index() ACGT = "ACGT" count = [0,0,0,0] for c in adn: count[ACGT.index(c)] += 1 for val in count: print(val,) print() # utilisation de la librairie collections from collections import defaultdict ncount = defaultdict(int) for c in adn: ncount[c] += 1 print(ncount['A'], ncount['C'], ncount['G'], ncount['T']) # collections.Counter from collections import Counter for k,v in sorted(Counter(adn).items()): print(v,) print() # avec un dictionnaire freq = {'A': 0, 'C': 0, 'G': 0, 'T': 0} for c in adn: freq[c] += 1 print(freq['A'], freq['C'], freq['G'], freq['T']) # avec un dictionnaire et count(), impression différente dico={} for base in bases: dico[base] = adn.count(base) for key,val in dico.items(): print("{} = {}".format(key, val))
Trouver un motif
+ lecture de fichier
- Finding_a_Protein_Motif-01.py
#!/usr/bin/env python # -*- coding: utf-8 -*- """ La description complète et les caractéristiques d'une protéine particulière peuvent être obtenues via l'ID "uniprot_id" de la "UniProt database", en insérant la référence dans ce lien : http://www.uniprot.org/uniprot/uniprot_id On peut aussi obtenir la séquence peptidique au format FASTA via le lien : http://www.uniprot.org/uniprot/uniprot_id.fasta """ from Bio import SeqIO from Bio import ExPASy from Bio import SeqIO dic = {"UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L", "UCU":"S", "UCC":"S", "UCA":"S", "UCG":"S", "UAU":"Y", "UAC":"Y", "UAA":"STOP", "UAG":"STOP", "UGU":"C", "UGC":"C", "UGA":"STOP", "UGG":"W", "CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L", "CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P", "CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q", "CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R", "AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M", "ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T", "AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K", "AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R", "GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V", "GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A", "GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E", "GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G",} aminoacids = ''.join(sorted(list(set([v for k,v in dic.items() if v != "STOP"])))) print(aminoacids) # UniProt Protein Database access IDs proteins = ['A2Z669', 'B5ZC00', 'P07204_TRBM_HUMAN', 'P20840_SAG1_YEAST'] handle = ExPASy.get_sprot_raw(proteins[0]) seq_record = SeqIO.read(handle, "swiss") handle.close() print() print(seq_record)
Références
- Biopython (librairie python de bioinformatique)
- cours introductif sur biopython :
- Introduction to Biopython VIB bioinformatics core, Kristian Rother, en particulier ce tutoriel
- Articles de la revue “Science in School” :
- Bioinformatics with pen and paper: building a phylogenetic tree Cleopatra Kozlowski, 07/12/2010
- Using biological databases to teach evolution and biochemistry, Germán Tenorio, 02/06/2014
- documentation sur les arbres phylogénétiques : https://biopython.org/wiki/Phylo
- Rosalind, plateforme d'apprentissage de la programmation en bioinformatique
- Catalog – Stepik cours et challenges en programmation, avec des activités en bioinformatique
- Bioinformatics Algorithms – Stepik (cours introductif)
- Bioinformatics Institute – Stepik (“institut virtuel” russe sur l'apprentissage de la bioinformatique)
- Bioinformatics Contest 2017 – Stepik concours de programmation 2017
- Bioinformatics Contest 2018 – Stepik concours de programmation 2018
- Bioinformatics Contest 2019 – Stepik concours de programmation 2019
- http://www.amberbiology.com/ & Python for the Life Sciences – A gentle introduction to Python for life scientists programmation privilégiant les modules standards de Python (pas le module biopython par exemple)
- Bioinformatics with Python Cookbook livre utilisant beaucoup la librairie biopython
- références sur la lecture de fichiers :