teaching:progappchim:bioinformatic [Didier Villers, UMONS

Cette page est en lecture seule. Vous pouvez afficher le texte source, mais ne pourrez pas le modifier. Contactez votre administrateur si vous pensez qu'il s'agit d'une erreur.
====== Bioinformatique ======
Un des objectifs majeurs de la [[wp>fr:Bio-informatique|bioinformatique]] réside dans l'étude automatique de séquences, principalement de l'ADN et de protéines,...

Ces séquences sont accessibles librement et publiquement, notamment par ces deux sources :

{{wp>fr:UniProt}}

Voir aussi le site [[https://www.uniprot.org/]]

{{wp>fr:GenBank}}

Voir aussi le site [[https://www.ncbi.nlm.nih.gov/genbank/]]

===== Installer Biopython =====

[[https://biopython.org/|Biopython]] est une librairie de programmes en langage Python dédiée à l'étude de séquences (ADN, ARN, protéines). Pour utiliser cette librairie, elle doit-être installée au préalable, par exemple :
  * Avec la distribution Anaconda, via l'interface Anaconda-Navigator, au départ du canal "conda-forge' ou par la commande suivante : conda install -c conda-forge biopython
  * via le site Pypi (pypi.org) et la commande suivante : pip install biopython



===== Compter les nucléotides d'une séquence ADN =====

<code python Counting_DNA_Nucleotides-01.py>
#!/usr/bin/env python
# -*- coding: utf-8 -*-
"""
On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T')
Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases
"""
adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

# utilisation d'une liste et de la méthode .count()
bases = ["A","C","G","T"]
for base in bases:
    print(adn.count(base),)
print()

# Variante :
for c in 'ACGT':
    print(adn.count(c),)
print()

# variante un peu moins lisible
out = []
for c in 'ACGT':
    out.append(str(adn.count(c)))
print(' '.join(out))

# utilisation de la technique "list comprehension"
count = [adn.count(c) for c in 'ACGT']
for val in count:
    print(val,)
print()

# autre "list comprehension", avec impression formatée → version "one line"
print("%d %d %d %d" % tuple([adn.count(X) for X in "ACGT"]))

# count "à la main", sans utilisation de fonctions/librairie
ACGT = "ACGT"
count = [0,0,0,0]
for c in adn:
    for i in range(len(ACGT)):
        if c == ACGT[i]:
            count[i] +=1
for val in count:
    print(val,)
print()

# count "à la main", avec .index()
ACGT = "ACGT"
count = [0,0,0,0]
for c in adn:
    count[ACGT.index(c)] += 1
for val in count:
    print(val,)
print()

# utilisation de la librairie collections
from collections import defaultdict
ncount = defaultdict(int)
for c in adn:
    ncount[c] += 1
print(ncount['A'], ncount['C'], ncount['G'], ncount['T'])

# collections.Counter
from collections import Counter
for k,v in sorted(Counter(adn).items()):
    print(v,)
print()

# avec un dictionnaire
freq = {'A': 0, 'C': 0, 'G': 0, 'T': 0}
for c in adn:
    freq[c] += 1
print(freq['A'], freq['C'], freq['G'], freq['T'])

# avec un dictionnaire et count(), impression différente
dico={}
for base in bases:
    dico[base] = adn.count(base)
for key,val in dico.items():
    print("{} = {}".format(key, val))
</code>


===== Trouver un motif =====
+ lecture de fichier

<code python Finding_a_Protein_Motif-01.py>
#!/usr/bin/env python
# -*- coding: utf-8 -*-
"""
La description complète et les caractéristiques d'une protéine particulière peuvent être obtenues via l'ID "uniprot_id" de la "UniProt database", en insérant la référence dans ce lien : 
http://www.uniprot.org/uniprot/uniprot_id

On peut aussi obtenir la séquence peptidique au format FASTA via le lien :
http://www.uniprot.org/uniprot/uniprot_id.fasta
"""

from Bio import SeqIO
from Bio import ExPASy
from Bio import SeqIO

dic = {"UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L",
    "UCU":"S", "UCC":"S", "UCA":"S", "UCG":"S",
    "UAU":"Y", "UAC":"Y", "UAA":"STOP", "UAG":"STOP",
    "UGU":"C", "UGC":"C", "UGA":"STOP", "UGG":"W",
    "CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L",
    "CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P",
    "CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q",
    "CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R",
    "AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M",
    "ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T",
    "AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K",
    "AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R",
    "GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V",
    "GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A",
    "GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E",
    "GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G",}

aminoacids = ''.join(sorted(list(set([v for k,v in dic.items() if v != "STOP"]))))
print(aminoacids)

# UniProt Protein Database access IDs
proteins = ['A2Z669', 'B5ZC00', 'P07204_TRBM_HUMAN', 'P20840_SAG1_YEAST'] 

handle = ExPASy.get_sprot_raw(proteins[0])
seq_record = SeqIO.read(handle, "swiss")
handle.close()
print()
print(seq_record)

</code>

===== Références =====
  * [[http://biopython.org/wiki/Main_Page|Biopython]] (librairie python de bioinformatique)
  * [[https://en.wikipedia.org/wiki/Bioinformatics]]
  * [[https://en.wikipedia.org/wiki/Open_Bioinformatics_Foundation]]
  * [[https://en.wikipedia.org/wiki/FASTA_format]]
  * [[https://en.wikipedia.org/wiki/List_of_open-source_bioinformatics_software]]
  * cours introductif sur biopython :
    * [[https://bioinformaticscore.sites.vib.be/en|VIB bioinformatics core]], en particulier [[https://data.bits.vib.be/pub/trainingen/Biopython/Basics_of_Biopython_1.1.pdf|ce tutoriel]]
  * [[https://www.bioinformaticsalgorithms.org/|Bioinformatics Algorithms]]
  * Articles de la revue "Science in School" :
    * [[https://www.scienceinschool.org/2010/issue17/bioinformatics|Bioinformatics with pen and paper: building a phylogenetic tree]] Cleopatra Kozlowski, 07/12/2010
    * [[https://www.scienceinschool.org/2014/issue29/online_bioinf|Using biological databases to teach evolution and biochemistry]], Germán Tenorio, 02/06/2014
  * documentation sur les arbres phylogénétiques : [[https://biopython.org/wiki/Phylo]]
  * [[http://rosalind.info/|Rosalind]], plateforme d'apprentissage de la programmation en bioinformatique
    * [[http://rosalind.info/glossary/|Glossaire de bioinformatique]]
  * [[https://stepik.org/catalog?language=en&q=bioinformatics|Catalog – Stepik]] cours et challenges en programmation, avec des activités en bioinformatique
    * [[https://stepik.org/course/2/promo|Bioinformatics Algorithms – Stepik]] (cours introductif)
    * [[https://stepik.org/org/bioinf|Bioinformatics Institute – Stepik]] ("institut virtuel" russe sur l'apprentissage de la bioinformatique)
    * [[https://stepik.org/course/945|Bioinformatics Contest 2017 – Stepik]] concours de programmation 2017
    * [[https://stepik.org/course/4377/promo|Bioinformatics Contest 2018 – Stepik]] concours de programmation 2018
    * [[https://stepik.org/course/43615/promo|Bioinformatics Contest 2019 – Stepik]]  concours de programmation 2019
  * [[http://www.amberbiology.com/]] & [[https://pythonforthelifesciences.com/|Python for the Life Sciences – A gentle introduction to Python for life scientists]] programmation privilégiant les modules standards de Python (pas le module biopython par exemple)
  * [[https://www.packtpub.com/eu/application-development/bioinformatics-python-cookbook|Bioinformatics with Python Cookbook]] livre utilisant beaucoup la librairie biopython
  * [[http://www.ncbi.nlm.nih.gov/genbank/|GenBank]]
  * références sur la lecture de fichiers :
    * [[http://www.uniprot.org/help/programmatic_access#id_mapping_python_example]]
    * [[http://www.python-simple.com/python-biopython/Lecture-ecriture-sequences.php]]
  * données exemples dans le cadre de la COVID-19 :
    * [[https://www.uniprot.org/uniprot/P0DTC2|S - Spike glycoprotein precursor - Severe acute respiratory syndrome coronavirus 2 (2019-nCoV) - S gene & protein]]