teaching:progappchim:dictionary_adn_protein

Traduction de l'ADN en séquence d'acides aminés

<sxh python; title : dictionary_adn_protein.py> #!/usr/bin/env python # -*- coding: iso-8859-1 -*-

# python code to translante DNA sequences into proteins # traduction de l'ADN en séquence d'acides aminés (protéine)

def translate_dna(sequence): # to translate a DNA sequence in equivalent protein

  # see http://fr.wikipedia.org/wiki/Code_g%C3%A9n%C3%A9tique
  # http://en.wikipedia.org/wiki/Genetic_code
  gencode = {                   # définition d'un dictionnaire dont chaque clé (un codon de 3 nucléotides) donne l'acide aminé correpondant
  'ATA':'I', 'ATC':'I', 'ATT':'I', 'ATG':'M',  
  'ACA':'T', 'ACC':'T', 'ACG':'T', 'ACT':'T',  
  'AAC':'N', 'AAT':'N', 'AAA':'K', 'AAG':'K',  
  'AGC':'S', 'AGT':'S', 'AGA':'R', 'AGG':'R',  
  'CTA':'L', 'CTC':'L', 'CTG':'L', 'CTT':'L',  
  'CCA':'P', 'CCC':'P', 'CCG':'P', 'CCT':'P',  
  'CAC':'H', 'CAT':'H', 'CAA':'Q', 'CAG':'Q',  
  'CGA':'R', 'CGC':'R', 'CGG':'R', 'CGT':'R',  
  'GTA':'V', 'GTC':'V', 'GTG':'V', 'GTT':'V',  
  'GCA':'A', 'GCC':'A', 'GCG':'A', 'GCT':'A',  
  'GAC':'D', 'GAT':'D', 'GAA':'E', 'GAG':'E',  
  'GGA':'G', 'GGC':'G', 'GGG':'G', 'GGT':'G',  
  'TCA':'S', 'TCC':'S', 'TCG':'S', 'TCT':'S',  
  'TTC':'F', 'TTT':'F', 'TTA':'L', 'TTG':'L',  
  'TAC':'Y', 'TAT':'Y', 'TAA':'_', 'TAG':'_',  
  'TGC':'C', 'TGT':'C', 'TGA':'_', 'TGG':'W',
  }
  print sequence  
  proteinseq = ''  
  for n in range(0,len(sequence),3):  
      if gencode.has_key(sequence[n:n+3]) == True:  # check that key exists in dictionary
          proteinseq += gencode[sequence[n:n+3]]  
  return proteinseq

# DNA sequences : GenBank : http://www.ncbi.nlm.nih.gov/

se='GTGACTTTGTTCAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGTAATCACTTGTTCTTTAAATAAGGACTAGTATGAATGGCATCACGAGGGCTTTACTGTCTCCTTTTTCTAATCAGTGAA' #se='GTGACTTTG' print len(se) print translate_dna(se)

# extensions : lire la séquence à partir d'un fichier # générer des mutations aléatoires de l'ADN et examiner les modifications éventuelles de la protéine # faire correspondre des noms complets ou abbréviations sur 3 lettres des acides aminés # générer l'ARN correspondant </sxh>

Ce site web utilise des cookies pour analyser le trafic de visites. En restant sur ce site, vous acceptez le stockage de cookies sur votre ordinateur. En savoir plus
  • teaching/progappchim/dictionary_adn_protein.txt
  • Dernière modification: 2012/11/30 13:28
  • de villersd