start

Recherche

Voici les résultats de votre recherche.

desinformationsplugin-autotooltip__default plugin-autotooltip_bigDes informations ou désinformations ?

Cette page regroupe quelques exemples d'informations et désinformations, notamment tirés de différents media : presse, réseaux sociaux, blogs, forums,... des désinformations, et parfois aussi une information qui se veut plus conforme aux faits.
@teaching
26 Occurrences trouvées, Dernière modification:
nofake.science/tribune/]] * [[https://www.facebook.com/CollectifNoFakeScience/]] * [[https://twi... uses <note tip>Subvention du Fact Checking : Facebook (et peut-être d'autres grosses entreprises) a sig... /www.climatechangecommunication.org/debunking-handbook-2020/|The Debunking Handbook 2020]] For more information on The Debunking Handbook 2020 including the c
jupyterplugin-autotooltip__default plugin-autotooltip_bigJupyter, IPython Notebooks et JupyterLab

* Jupyter a succédé à IPython Notebook * Jupyter est installé par défaut avec la distribution python Anaconda. C'est la manière la plus adéquate d'utiliser Jupyter. * Sinon, on peut utiliser facilement les notebooks Jupyter sur la plateforme
@teaching:progappchim
25 Occurrences trouvées, Dernière modification:
ound tip 60%> * Jupyter a succédé à IPython Notebook * Jupyter est installé par défaut avec la distr... ncé permettant de travailler en équipe sur un notebook * [[https://dataplatform.cloud.ibm.com/docs/c... viewer]], pour partager une vue statique d'un notebook * Le passé (récent) : * [[http://ipython.org|IPython notebook]] * [[http://ipython.org/ipython-doc/stable/i
pythonplugin-autotooltip__default plugin-autotooltip_bigPython : quelques références, trucs et astuces

Python est un langage de programmation de haut niveau, libre, polyvalent, facilement accessible aux débutants, mais permettant aussi de réaliser des applications sophistiquées et professionnelles. Certains l'utilisent simplement comme langage de script, pour automatiser et faciliter différentes tâches informatiques.
@floss
25 Occurrences trouvées, Dernière modification:
ndows, GNU/Linux, Mac OS), avec le système de Notebook web Jupyter en prime... Si les conditions sont li... ipython ipython-qtconsole ipython-doc ipython-notebook python-pip python-scitools mayavi2 python-numexpr... n]] * Livre "[[http://www.springer.com/math/cse/book/978-3-642-02474-0|A Primer on Scientific Programm... 009 * Livre "[[http://www.springer.com/math/cse/book/978-3-540-73915-9|Python Scripting for Computatio
ressources_educatives_libresplugin-autotooltip__default plugin-autotooltip_bigRessources éducatives libres

Cette page répertorie des ressources libres, au sens du domaine public ou des licences de type Creative Commons CC-BY-SA, CC-BY, ou CC-Zero, compatibles par exemple avec Wikipedia (qui est sous licence CC-BY-SA).

Précision sur la notion de libre, opensource, ouvert(ure)
@floss
22 Occurrences trouvées, Dernière modification:
July 2014 * [[https://open-science-training-handbook.gitbooks.io/book/content/|The Open Science Training Handbook]] (licence CC0) * [[http://oedb.org/ilibrarian/80-oer-too... com/boundless-physics/|Boundless Physics | Simple Book Publishing]] * [[https://courses.lumenlearnin
initinfoplugin-autotooltip__default plugin-autotooltip_bigInitiation à l'informatique

Cours libre en ligne à destination des étudiants de la section chimie. Si vous avez des questions ou souhaits de compléments d'informations, ou d'ajouts de rubriques, vous pouvez utiliser ce formulaire de contact.

Les bases de l'informatique
@teaching
11 Occurrences trouvées, Dernière modification:
Forty percent of the people in the U.S. read one book or less last year. The whole conception is flawed... Steve Jobs, Apple, 2008, à propos du lecteur de e-book Kindle de Amazon. ==== Quelques faits intéressant... t/Thunderbird/Introduction]] et [[http://www.framabook.org/thunderbird.html]]). Lors de l'envoi d'email... rg/Pack/PackLatex]] (//cf.// la [[http://www.framabook.org/latex.html|documentation]]). Le site [[http:
tkinter_gui_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases d'un interface graphique avec Tkinter

Quelques références de base pour utiliser Tkinter

* Documentation officielle : * Les interfaces graphiques TK * tkinter — interface Python à Tcl/Tk, reprenant quelques références recommandées * Python 3 avec Tk intègre également les extensions
@teaching:progappchim
9 Occurrences trouvées, Dernière modification:
dh]] (tutoriel Tk) * [[http://effbot.org/tkinterbook/|An Introduction to Tkinter, sur effbot.org]] *... |ici]], ou sur eefbot ([[http://effbot.org/tkinterbook/grid.htm|grid]], [[http://effbot.org/tkinterbook/pack.htm|pack]], et [[http://effbot.org/tkinterbook/place.htm|place]]). ===== Champ d'entrée (Entry) =
psychologie_de_l_educationplugin-autotooltip__default plugin-autotooltip_bigPsychologie de l'éducation

Thématiques reliées : neurosciences, cognition/métacognition, motivation,...

À ajouter :

* Sweller, cognitive Load,... * Paul A. Kirschner, Carl Hendrick : How Learning Happens - Seminal Works in Educational Psychology and What They Mean in Practice Routledge (2020) * meta-cognition... (ou une thématique spécifique de neuro-éducation
@teaching
7 Occurrences trouvées, Dernière modification:
creased interpretability of results. Finally, the book reviews a number of “quasi-experimental” research... 77). **Aptitudes and instructional methods: A handbook for research on interactions**. New York, NY: Irv... 972, Allen Newell and Herbert Simon published the book Human Problem Solving, in which they outlined the... is described as “. . . perhaps the most important book on the scientific study of human thinking in the
pandasplugin-autotooltip__default plugin-autotooltip_bigPandas

Module pour l'analyse de données, pouvant se substituer à l'utilisation d'un tableur. Une différence fondamentale de la librairie pandas avec NumPy, c'est que les tableaux NumPy (NumPy arrays) ont le même type (dtype) pour le tableau entier, tandis que les tableaux pandas (pandas DataFrames) sont caractérisés par un type unique (dtype) par colonne.$X$$x$$P(x)$$X$$x$$x_1, x_2, x_3, \ldots$$X$$P(x_i)$$X$$x$$P(x)$$x$$x+dx$$P(x)$$x$$P(x) dx$$P(x) dx = P(x \le X < x+dx)$$P(x_i) \ge 0$$x_i$$P(…
@teaching:progappchim
7 Occurrences trouvées, Dernière modification:
://pandas.pydata.org/pandas-docs/version/0.20/cookbook.html|cookbook]] * [[http://pandas.pydata.org/pandas-docs/stable/user_guide/visualization.html|Visuali... b1c21b]] (limité) * [[http://www.firstpythonnotebook.org/index.html|First Python Notebook. A step-by-step guide to analyzing data with Python and the Jupyte
methcalchimplugin-autotooltip__default plugin-autotooltip_bigCalculation methods applied to chemistry

Synopsis (english)

Mathematical prerequisites

Programming bases and tools

* Python programming language * LearnPython.org interactive tutorial with code execution * DataCamp free course "Intro to Python for Data Science" * Python 3 Tutorial, interactive, with code use in web browser * MOOCs (massive open online courses) :
@teaching:methcalchim
7 Occurrences trouvées, Dernière modification:
* Includes these tools : * Jupyter notebook (interactive web-based environment) * qtcon... * [[https://medium.com/@denkasyanov/jupyter-notebook-tutorial-9c0ffa5ae9a1#.ufaor34wp|Jupyter Notebook Tutorial]], par Den Kasyanov (Medium) * [[https:/... tps://www.datacamp.com/community/blog/jupyter-notebook-cheat-sheet|Jupyter DataCamp Cheat Sheet]] <note
cuisine_moleculaireplugin-autotooltip__default plugin-autotooltip_bigLa cuisine moléculaire

L'alimentation serait à l'origine de nos capacités neuronales plus importantes : cf. Suzana Herculano-Houzel’s TED talk

Situations d'apprentissage

* la mayonnaise ratée * l'œuf est très souvent trop cuit : * le jaune devient verdâtre * le jaune est trop sec
@teaching
6 Occurrences trouvées, Dernière modification:
ora.com * [[https://www.uoguelph.ca/foodscience/book-page/ice-cream-ebook|The Ice Cream eBook]], Professor H. Douglas Goff, University of Guelph, Canada * Chris Clarke, [[https://pubs.rsc.org/en/content/ebook/978-0-85404-629-4|The Science of Ice Cream]] (Roy
articles_didactique_chimieplugin-autotooltip__default plugin-autotooltip_bigSélection d'articles en didactique de la chimie

Liens rapides :

* : numéro courant de Journal of Chemical Education où vous avez la possibilité de consulter les résumés. Si vous souhaitez recevoir la table des matières à chaque nouveau numéro, il vous suffit de prendre l'option
@teaching
6 Occurrences trouvées, Dernière modification:
and an Online HPLC Simulator Using a Jupyter Notebook on the Chem Compute Web site]] * [[https://pu... nary Evidence on the Effect of an Open-Source Textbook in Second-Year Undergraduate Analytical Chemistry... ssroom]], 2nd Edition (Stacey Lowery Bretz, Ed.), book review, J. Chem. Educ. 2009, 86(4), 435 DOI: 10.... rauer, Amanda Landis (DOI: 10.1021/ed2005664) * Book & Media Reviews * [[http://c.acs.org/camav/51
latexplugin-autotooltip__default plugin-autotooltip_bigLaTeX : quelques références et astuces pour son utilisation

TeX est un langage de composition typographique adapté à la production de documents techniques, scientifiques et mathématiques de grande qualité typographique. Il permet également de produire toutes sortes d'autres documents, qu'il s'agisse de simples lettres ou de livres entiers. LaTeX est un regroupement de macros qui utilisent TeX comme outil de mise en page. TeX et LaTeX sont des logiciels libres et gratuits. LaTeX a été initiale…
@floss
5 Occurrences trouvées, Dernière modification:
des références suivantes : * [[http://www.framabook.org/latex.html|« Tout ce que vous avez toujours v... mander »]], un livre libre (et gratuit) chez framabook * [[http://www.ctan.org/tex-archive/info/lshort... [[http://en.wikibooks.org/wiki/LaTeX/PGF/TikZ|wikibook LaTeX]] (LaTeX/PGF/TikZ) * [[http://www.math.... X pour écrire des formules mathématiques avec Facebook Messenger : [[https://www.reddit.com/r/math/comme
matplotlib_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Matplotlib, une librairie pour réaliser des graphiques 2D

Matplotlib est une bibliothèque très puissante du langage de programmation Python destinée à tracer et visualiser des données sous formes de graphiques. Elle est souvent combinée avec les bibliothèques python de calcul scientifique :
@teaching:progappchim
5 Occurrences trouvées, Dernière modification:
[[https://jakevdp.github.io/PythonDataScienceHandbook/04.11-settings-and-stylesheets.html|Customizing M... rations and Stylesheets | Python Data Science Handbook]] * [[https://matplotlib.org/3.2.1/gallery/styl... df]] (1311 pages) * [[http://wiki.scipy.org/Cookbook/Matplotlib/|Cookbook Matplotlib]] * [[http://fr.wikipedia.org/wiki/Matplotlib|Matplolib sur Wikipédia
radonplugin-autotooltip__default plugin-autotooltip_bigRadon

FIXME : page à compléter

Activité via la plateforme numérique LabNbook

* * Tester la plateforme : Radon-démo : Détermination de la demi-vie du radon 220

...
@teaching
4 Occurrences trouvées, Dernière modification:
r ===== Activité via la plateforme numérique LabNbook ===== * [[https://labnbook.fr/platform/]] * [[https://labnbook.fr/test/|Tester la plateforme]] : [[https://uga.labnbook.fr/report/test|Radon-démo : Détermination de la d
dokuwikiplugin-autotooltip__default plugin-autotooltip_bigDokuWiki

* Présentations : * DokuWiki, un wiki "One size fits all" : conférence JDL du 20 février 2020 * Présentation JDL du 20 février 2020 (slideshow) * rss (test-rss) * tables (test-table) * Extensions

* Dokuwiki, un wiki polyvalent et efficace aux nombreuses fonctionnalités

* fr:DokuWiki : sur wikipédia * DokuWiki : sur wikipedia en anglais * : site web officiel * : gitHub reposit…
@floss
4 Occurrences trouvées, Dernière modification:
on, contenu, moment,...) * réseaux sociaux (Facebook, Twitter, Instagram,...) * [[https://www.doku... /plugin:importfacebookevents]] → display your Facebook events * [[https://www.dokuwiki.org/plugin:facebook]] → Add Facebook Fan Boxes * [[https://www.dokuwiki.org/plugin:socialcards|socialcards]] * [[ht
altair_simpleplugin-autotooltip__default plugin-autotooltip_bigles bases de Altair, une librairie graphique interactive

* Altair: Declarative Visualization in Python — Altair 4.1.0 documentation * altair · PyPI * (Tutorial) Altair in Python: Data Visualizations - DataCamp * Python Interactive Data Visualization with Altair - Towards Data Science * Stackoverflow * python - Altair not rendering chart in jupyter notebook - Stack Overflow * python - Not able to display altair charts in jupyter notebook - Stack Overflow
@teaching:progappchim
4 Occurrences trouvées, Dernière modification:
plotly_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Plotly

Plotly ( est une société développant des outils analytiques et de visualisation. La librairie python Plotly permet de créer des graphes dans l'environnement de Jupyter. FIXME : à compléter

Références

* plot.ly, le site officiel
@teaching:progappchim
4 Occurrences trouvées, Dernière modification:
numpy_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de NumPy

NumPy est une extension du langage de programmation Python, destinée à manipuler des matrices ou tableaux multidimensionnels ainsi que des fonctions mathématiques opérant sur ces tableaux.

Numpy permet la manipulations des vecteurs, matrices et polynômes.
@teaching:progappchim
3 Occurrences trouvées, Dernière modification:
revision_cheat_sheetsplugin-autotooltip__default plugin-autotooltip_bigRevision & cheat sheets

Orphan page

* Revision sheet - revision sheets * Cheat sheet - cheat sheets

FIXME

Chimie

Cheat Sheets de G.I.T. Laboratory Journal

* Lien général : * The Analytical Balance * Cleaning Laboratory Glassware * Laboratory Burners (#3 2018, p11) * Freezing Mixtures for Everyday Laboratory Use (#1 2018, p12)

Physique

*
@teaching
2 Occurrences trouvées, Dernière modification:
notions_fondamentalesplugin-autotooltip__default plugin-autotooltip_bigNotions fondamentales

Aide mémoire synthétique sur le langage Python. Les différences importantes entre la branche 2 et la branche 3 seront commentées. La différence la plus fréquente est le passage de print à print() !

Règles de base

Ces règles peuvent être testées via le mode interactif de Python (en utilisant la fenêtre
@teaching:progappchim
2 Occurrences trouvées, Dernière modification:
mapathonplugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 25 mars 2020

FIXME : page pour l'édition 2020 en construction !!

Liens rapides :

* Présentation introductive générale du Mapathon 2020 * Les instructions pour faire de la carto humanitaire libre "HOT OSM" (source) * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule
2 Occurrences trouvées, Dernière modification:
physicochimie_1plugin-autotooltip__default plugin-autotooltip_bigPhysicoChimie I

Bachelier en sciences chimiques, deuxième année, 30 H cours et 30 H travaux pratiques, en co-suppléance avec P. Damman et S. Gabriele)

FIXME : contenus à ajouter sur la partie “phénomènes de transport”.

Références

*
@teaching
2 Occurrences trouvées, Dernière modification:
bioinformaticplugin-autotooltip__default plugin-autotooltip_bigBioinformatique

Manipulations de séquences ADN, ARN, protéines,...

Compter les nucléotides d'une séquence ADN

#!/usr/bin/env python # -*- coding: utf-8 -*- """ On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T') Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases """ adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

# utilisation d'une liste et de la méthode .count() base…
@teaching:progappchim
2 Occurrences trouvées, Dernière modification:
stackexchange-chimieplugin-autotooltip__default plugin-autotooltip_bigQuestions et réponses en chimie sur chemistry.stackexchange

Chemistry Stack Exchange est un site de questions et réponses pour les scientifiques, les enseignants, les étudiants,... Il est gratuit, est son contenu est sous licence libre (copyleft) Creative Commons BY-SA. Aucune inscription n'est requise pour la consultation. Vous devez vous identifier pour y contribuer. Le fonctionnement est réglé par un système de
@teaching
2 Occurrences trouvées, Dernière modification:
hcq-20200523plugin-autotooltip__default plugin-autotooltip_bigHCQ 23 mai 2020

* → fin de partie

⛔ Chloroquine à la Marseillaise : fin de partie ! ⛔

[⚠ Avertissement : ceci est un long article qui ne cherche pas à vous faire croire mais tentera d’expliquer et, en toute fin, de lister des ressources pour aller vérifier par vous-mêmes les données scientifiques et pas celle de Gérard, médecin épidémiologiste depuis 3 jours après formation Doctissimo ⚠]
@teaching
1 Occurrences trouvées, Dernière modification:
videos_chimie_sgplugin-autotooltip__default plugin-autotooltip_bigVidéos pour le cours de chimie sciences générales





Cette page reprend des références de vidéos utilisables dans un cours de chimie “Sciences générales”, suivant le programme du réseau officiel de la FWB. Ces vidéos sont évidemment tout aussi exploitables pour un autre cours de chimie (autre programme, sciences …
@teaching
1 Occurrences trouvées, Dernière modification:
aluminiumplugin-autotooltip__default plugin-autotooltip_bigAluminimum

FIXME : à compléter

* Aluminium et lave-vaisselle : c'est proscrit, l'eau de lavage étant basique ? vérifier, donner les réactions...

Activités diverses

* : “A possible activity with new y12s is to take a single chemical reaction and use this as a basis to explore chemistry they learned
@teaching
1 Occurrences trouvées, Dernière modification:
bluetoothplugin-autotooltip__default plugin-autotooltip_bigBluetooth - astuces diverses

* Profils audio (casques, enceintes connectées,...) : * HSP (Headset Profile ou Profil casque) : offre les fonctionnalités de base pour établir la communication entre un combiné (le téléphone portable) et un casque.
@floss
1 Occurrences trouvées, Dernière modification:
teaching_ressources_videosplugin-autotooltip__default plugin-autotooltip_bigRessources pour la création de séquences vidéos et l'enseignement à distance

Conseils généraux pour la conception

* conseils, longueurs, styles,... * Planifier, réaliser et diffuser des vidéos éducatives : lignes directrices et astuces pour les enseignants, Caroline Cormier, Edward Awad, Yann Brouillette et Véronique Turcotte (canada). Article reprenant des exemples de capsule en chimie (
@teaching
1 Occurrences trouvées, Dernière modification:
anacondaplugin-autotooltip__default plugin-autotooltip_bigAnaconda

* Distribution python libre et multiplateforme (Windows, GNU/Linux, Mac OS), avec le système de Notebook web Jupyter en prime… Si les conditions sont limitées (matériel, réseau,…), il peut être plus intéressant d'installer la version
@floss
1 Occurrences trouvées, Dernière modification:
progappchimplugin-autotooltip__default plugin-autotooltip_bigProgrammation appliquée à la chimie

Le cours “Programmation appliquée à la chimie” de bachelier en sciences chimiques (15 H cours et 15 H exercices, bloc2) utilise deux supports :

* Principalement, le présent wiki pour ses avantages techniques (coloration et indentation du code, recherche dans les pages, historique des modifications,
@teaching:progappchim
1 Occurrences trouvées, Dernière modification:
representation_molecules_2013plugin-autotooltip__default plugin-autotooltip_bigReprésentation de molécules

Page à actualiser...

Certaines fonctions de ce programme nécessite des fichiers de données : [base.csv] et [bdd.csv] #!/usr/bin/env python # -*- coding: UTF-8 -*- # travail de RL, ba2 chimie 2012-2013
@teaching:progappchim
1 Occurrences trouvées, Dernière modification:
kirschner-how_learning_happensplugin-autotooltip__default plugin-autotooltip_bigHow learning happens - Comment l'apprentissage se fait

* Livre How Learning Happens - Seminal Works in Educational Psychology and What They Mean in Practice, 1st Edition, By Paul A. Kirschner, Carl Hendrick, Routledge 04/03/2020 ISBN: 9780367184575

Contenus
@teaching
1 Occurrences trouvées, Dernière modification:
potentiel_energy_surfaceplugin-autotooltip__default plugin-autotooltip_bigSurface d'énergie potentielle

Historique

Eyring et Polanyi ont publié en 1931 l'article On Simple Gas Reactions dans lequel ils décrivent les trajets des atomes dans la réaction + H --> H + (échange d'atomes). Ces travaux aboutiront au développement des notions de $E_{bond}= D_e [\exp(-2\beta(r-r_e))-2\exp(-\beta(r-r_e))]$$E_{ant}= \frac{D_e}{2} [\exp(-2\beta(r-r_e))+2\exp(-\beta(r-r_e))]$$r_e$$D_e$$\beta$$E_{bond}= \frac{Q_{AB}+\alpha_{AB}}{1+S^2_{AB}} = \frac{Q_{AB}+\alpha_{AB}}{1+k}$$E_{a…
@teaching:progappchim:matplotlib_gallery
1 Occurrences trouvées, Dernière modification:
biblio-didactique-chimieplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes en didactique de la chimie, mais pas seulement

La plupart des résumés de publications sont issus d'analyses d'articles effectuées par des étudiants dans le cadre des études d'AESS en chimie ou de bacheliers/masters en chimie (les initiales et années sont alors indiquées), pour des publications souvent issues de cette
@teaching
1 Occurrences trouvées, Dernière modification:
elements_moleculesplugin-autotooltip__default plugin-autotooltip_bigÉléments et molécules

Les propriétés des éléments chimiques, de molécules peuvent être dressées, listées,... par un programme si on dispose des données. Celles-ci étant communes à tous les chimistes, et uniquement susceptibles de quelques modifications, il est utile de reprendre une source commune primaire (IUPAC) ou secondaire (comme Wikipedia) plutôt que de redéfinir toutes ces valeurs dans un programme.
@teaching:progappchim
1 Occurrences trouvées, Dernière modification:
  • start.txt
  • Dernière modification: 2020/10/02 14:58
  • de villersd