

Voici les résultats de votre recherche.

  • ebook (wiki)plugin-autotooltip__default
  • ebook_help (wiki)plugin-autotooltip__default plugin-autotooltip_bigCréation d'un ebook

    Dès que vous avez utilisé l'icône de la barre latérale “Ajouter au livre”, vous aurez en tête de chaque page disponible un bandeau vous donnant accès à un créateur de livre. Vous pouvez facilement ajouter ou enlever toute page (comme avec l'icône du bandeau latéral), vous rendre vers le gestionnaire pour
desinformationsplugin-autotooltip__default plugin-autotooltip_bigDes informations ou désinformations ?

Cette page regroupe quelques exemples d'informations et désinformations, notamment tirés de différents media : presse, réseaux sociaux, blogs, forums,... des désinformations, et parfois aussi une information qui se veut plus conforme aux faits.
26 Occurrences trouvées, Dernière modification:]] * [[]] * [[https://twi... uses <note tip>Subvention du Fact Checking : Facebook (et peut-être d'autres grosses entreprises) a sig... /|The Debunking Handbook 2020]] For more information on The Debunking Handbook 2020 including the c
pythonplugin-autotooltip__default plugin-autotooltip_bigPython : quelques références, trucs et astuces

Python est un langage de programmation de haut niveau, libre, polyvalent, facilement accessible aux débutants, mais permettant aussi de réaliser des applications sophistiquées et professionnelles. Certains l'utilisent simplement comme langage de script, pour automatiser et faciliter différentes tâches informatiques.
25 Occurrences trouvées, Dernière modification:
ndows, GNU/Linux, Mac OS), avec le système de Notebook web Jupyter en prime... Si les conditions sont li... ipython ipython-qtconsole ipython-doc ipython-notebook python-pip python-scitools mayavi2 python-numexpr... n]] * Livre "[[|A Primer on Scientific Programm... 009 * Livre "[[|Python Scripting for Computatio
jupyterplugin-autotooltip__default plugin-autotooltip_bigJupyter, IPython Notebooks et JupyterLab

* Jupyter a succédé à IPython Notebook * Jupyter est installé par défaut avec la distribution python Anaconda. C'est la manière la plus adéquate d'utiliser Jupyter. * Sinon, on peut utiliser facilement les notebooks Jupyter sur la plateforme
24 Occurrences trouvées, Dernière modification:
ound tip 60%> * Jupyter a succédé à IPython Notebook * Jupyter est installé par défaut avec la distr... ncé permettant de travailler en équipe sur un notebook * [[ viewer]], pour partager une vue statique d'un notebook * Le passé (récent) : * [[|IPython notebook]] * [[
ressources_educatives_libresplugin-autotooltip__default plugin-autotooltip_bigRessources éducatives libres

Cette page répertorie des ressources libres, au sens du domaine public ou des licences de type Creative Commons CC-BY-SA, CC-BY, ou CC-Zero, compatibles par exemple avec Wikipedia (qui est sous licence CC-BY-SA).

Précision sur la notion de libre, opensource, ouvert(ure)
22 Occurrences trouvées, Dernière modification:
July 2014 * [[|The Open Science Training Handbook]] (licence CC0) * [[ com/boundless-physics/|Boundless Physics | Simple Book Publishing]] * [[https://courses.lumenlearnin
initinfoplugin-autotooltip__default plugin-autotooltip_bigInitiation à l'informatique

Cours libre en ligne à destination des étudiants de la section chimie. Si vous avez des questions ou souhaits de compléments d'informations, ou d'ajouts de rubriques, vous pouvez utiliser ce formulaire de contact.

Les bases de l'informatique
11 Occurrences trouvées, Dernière modification:
Forty percent of the people in the U.S. read one book or less last year. The whole conception is flawed... Steve Jobs, Apple, 2008, à propos du lecteur de e-book Kindle de Amazon. ==== Quelques faits intéressant... t/Thunderbird/Introduction]] et [[]]). Lors de l'envoi d'email... rg/Pack/PackLatex]] (//cf.// la [[|documentation]]). Le site [[http:
tkinter_gui_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases d'un interface graphique avec Tkinter

Quelques références de base pour utiliser Tkinter

* Documentation officielle : * Les interfaces graphiques TK * tkinter — interface Python à Tcl/Tk, reprenant quelques références recommandées * Python 3 avec Tk intègre également les extensions
9 Occurrences trouvées, Dernière modification:
dh]] (tutoriel Tk) * [[|An Introduction to Tkinter, sur]] *... |ici]], ou sur eefbot ([[|grid]], [[|pack]], et [[|place]]). ===== Champ d'entrée (Entry) =
psychologie_de_l_educationplugin-autotooltip__default plugin-autotooltip_bigPsychologie de l'éducation

Thématiques reliées : neurosciences, cognition/métacognition, motivation,...

À ajouter :

* Sweller, cognitive Load,... * Paul A. Kirschner, Carl Hendrick : How Learning Happens - Seminal Works in Educational Psychology and What They Mean in Practice Routledge (2020) * meta-cognition... (ou une thématique spécifique de neuro-éducation
7 Occurrences trouvées, Dernière modification:
creased interpretability of results. Finally, the book reviews a number of “quasi-experimental” research... 77). **Aptitudes and instructional methods: A handbook for research on interactions**. New York, NY: Irv... 972, Allen Newell and Herbert Simon published the book Human Problem Solving, in which they outlined the... is described as “. . . perhaps the most important book on the scientific study of human thinking in the
methcalchimplugin-autotooltip__default plugin-autotooltip_bigCalculation methods applied to chemistry

Synopsis (english)

Mathematical prerequisites

Programming bases and tools

* Python programming language * interactive tutorial with code execution * DataCamp free course "Intro to Python for Data Science" * Python 3 Tutorial, interactive, with code use in web browser * MOOCs (massive open online courses) :
7 Occurrences trouvées, Dernière modification:
* Includes these tools : * Jupyter notebook (interactive web-based environment) * qtcon... * [[|Jupyter Notebook Tutorial]], par Den Kasyanov (Medium) * [[https:/... tps://|Jupyter DataCamp Cheat Sheet]] <note
pandasplugin-autotooltip__default plugin-autotooltip_bigPandas

Module pour l'analyse de données, pouvant se substituer à l'utilisation d'un tableur. Une différence fondamentale de la librairie pandas avec NumPy, c'est que les tableaux NumPy (NumPy arrays) ont le même type (dtype) pour le tableau entier, tandis que les tableaux pandas (pandas DataFrames) sont caractérisés par un type unique (dtype) par colonne.$X$$x$$P(x)$$X$$x$$x_1, x_2, x_3, \ldots$$X$$P(x_i)$$X$$x$$P(x)$$x$$x+dx$$P(x)$$x$$P(x) dx$$P(x) dx = P(x \le X < x+dx)$$P(x_i) \ge 0$$x_i$$P(…
7 Occurrences trouvées, Dernière modification:
://|cookbook]] * [[|Visuali... b1c21b]] (limité) * [[|First Python Notebook. A step-by-step guide to analyzing data with Python and the Jupyte
articles_didactique_chimieplugin-autotooltip__default plugin-autotooltip_bigSélection d'articles en didactique de la chimie

Liens rapides :

* : numéro courant de Journal of Chemical Education où vous avez la possibilité de consulter les résumés. Si vous souhaitez recevoir la table des matières à chaque nouveau numéro, il vous suffit de prendre l'option
6 Occurrences trouvées, Dernière modification:
and an Online HPLC Simulator Using a Jupyter Notebook on the Chem Compute Web site]] * [[https://pu... nary Evidence on the Effect of an Open-Source Textbook in Second-Year Undergraduate Analytical Chemistry... ssroom]], 2nd Edition (Stacey Lowery Bretz, Ed.), book review, J. Chem. Educ. 2009, 86(4), 435 DOI: 10.... rauer, Amanda Landis (DOI: 10.1021/ed2005664) * Book & Media Reviews * [[
cuisine_moleculaireplugin-autotooltip__default plugin-autotooltip_bigLa cuisine moléculaire

L'alimentation serait à l'origine de nos capacités neuronales plus importantes : cf. Suzana Herculano-Houzel’s TED talk

Situations d'apprentissage

* la mayonnaise ratée * l'œuf est très souvent trop cuit : * le jaune devient verdâtre * le jaune est trop sec
6 Occurrences trouvées, Dernière modification: * [[|The Ice Cream eBook]], Professor H. Douglas Goff, University of Guelph, Canada * Chris Clarke, [[|The Science of Ice Cream]] (Roy
latexplugin-autotooltip__default plugin-autotooltip_bigLaTeX : quelques références et astuces pour son utilisation

TeX est un langage de composition typographique adapté à la production de documents techniques, scientifiques et mathématiques de grande qualité typographique. Il permet également de produire toutes sortes d'autres documents, qu'il s'agisse de simples lettres ou de livres entiers. LaTeX est un regroupement de macros qui utilisent TeX comme outil de mise en page. TeX et LaTeX sont des logiciels libres et gratuits. LaTeX a été initiale…
5 Occurrences trouvées, Dernière modification:
des références suivantes : * [[|« Tout ce que vous avez toujours v... mander »]], un livre libre (et gratuit) chez framabook * [[ [[|wikibook LaTeX]] (LaTeX/PGF/TikZ) * [[http://www.math.... X pour écrire des formules mathématiques avec Facebook Messenger : [[
scipy_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de SciPy

La librairie SciPy ajoute à NumPy des fonctionnalités mathématiques.

Directive d'importation

* Méthode standard : import scipy as sp

* Importation par sous-modules (cf le site de Scipy) : from scipy import optimize from scipy import interpolate from scipy import integrate ...
5 Occurrences trouvées, Dernière modification:
ulier, les anciennes éditions sont [[|accessibles gratuitement]] à l... aux, Ralf Gommers * [[|Cookbook]] * [[
matplotlib_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Matplotlib, une librairie pour réaliser des graphiques 2D

Matplotlib est une bibliothèque très puissante du langage de programmation Python destinée à tracer et visualiser des données sous formes de graphiques. Elle est souvent combinée avec les bibliothèques python de calcul scientifique :
5 Occurrences trouvées, Dernière modification:
[[|Customizing M... rations and Stylesheets | Python Data Science Handbook]] * [[ df]] (1311 pages) * [[|Cookbook Matplotlib]] * [[|Matplolib sur Wikipédia
dokuwikiplugin-autotooltip__default plugin-autotooltip_bigDokuWiki

* Présentations : * DokuWiki, un wiki "One size fits all" : conférence JDL du 20 février 2020 * Présentation JDL du 20 février 2020 (slideshow) * rss (test-rss) * tables (test-table) * Extensions

* Dokuwiki, un wiki polyvalent et efficace aux nombreuses fonctionnalités

* fr:DokuWiki : sur wikipédia * DokuWiki : sur wikipedia en anglais * : site web officiel * : gitHub reposit…
4 Occurrences trouvées, Dernière modification:
on, contenu, moment,...) * réseaux sociaux (Facebook, Twitter, Instagram,...) * [[https://www.doku... /plugin:importfacebookevents]] → display your Facebook events * [[]] → Add Facebook Fan Boxes * [[|socialcards]] * [[ht
plotly_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Plotly

Plotly ( est une société développant des outils analytiques et de visualisation. La librairie python Plotly permet de créer des graphes dans l'environnement de Jupyter. FIXME : à compléter


*, le site officiel
4 Occurrences trouvées, Dernière modification:
radonplugin-autotooltip__default plugin-autotooltip_bigRadon

FIXME : page à compléter

Activité via la plateforme numérique LabNbook

* * Tester la plateforme : Radon-démo : Détermination de la demi-vie du radon 220

4 Occurrences trouvées, Dernière modification:
glossaire-chimieplugin-autotooltip__default plugin-autotooltip_bigGlossaire de termes usuels de chimie

Ce glossaire reprend principalement les termes chimiques utilisés dans le cours de chimie de l'enseignement secondaire belge (cf. les unités d'acquis d'apprentissage de chimie en sciences générales). Le niveau des définitions est adapté au niveau d'étude. L'ensemble est placé sous licence libre $\chi_{A}$
4 Occurrences trouvées, Dernière modification:
simulations_random_walks_codesplugin-autotooltip__default plugin-autotooltip_bigSimulations numériques de marches aléatoires : programmes en Python

Génération de nombres aléatoires

#!/usr/bin/python # -*- coding: utf-8 -*- """ cf. documentation cf random number generation - génération de nombres aléatoires functions of interest : choice, randint, seed """

from random import *

facepiece = ['pile','face'] valeurpiece = [0.01,0.02,0.05,0.1,0.2,0.5,1.,2.]

for i in range(1): # choice : random choice of an element from a lis…
4 Occurrences trouvées, Dernière modification:
etudes-aessplugin-autotooltip__default plugin-autotooltip_bigGénéralités sur l'agrégation et les masters à finalité didactique en Faculté des Sciences

wiki du service de didactique des disciplines scientifiques * lien direct :
4 Occurrences trouvées, Dernière modification:
altair_simpleplugin-autotooltip__default plugin-autotooltip_bigles bases de Altair, une librairie graphique interactive

* Altair: Declarative Visualization in Python — Altair 4.1.0 documentation * altair · PyPI * (Tutorial) Altair in Python: Data Visualizations - DataCamp * Python Interactive Data Visualization with Altair - Towards Data Science * Stackoverflow * python - Altair not rendering chart in jupyter notebook - Stack Overflow * python - Not able to display altair charts in jupyter notebook - Stack Overflow
4 Occurrences trouvées, Dernière modification:
system_of_linear_equationsplugin-autotooltip__default plugin-autotooltip_bigSystem of linear equations

Time_complexityi.e. Theory

* System_of_linear_equations * Gaussian_elimination, Gauss and Gauss-Jordan eliminations (diagonalization, triangularization) * Pivot_element, pivoting * LU_decomposition * Triangular_matrix

* Chapter 2 in the book “Numerical Recipes” : * 2.0 Introduction * 2.1 Gauss-Jordan Elimination
3 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00676plugin-autotooltip__default plugin-autotooltip_bigQuantification des concentrations de protéines à l'aide de la colorimétrie par un Smartphone: une nouvelle méthode pour un test établi

Article: Quantifying Protein Concentrations Using Smartphone Colorimetry: A New Method for an Established Test T. Gee, Eric Kehoe, William C. K. Pomerantz, and R. Lee Penn, J. Chem. Educ., 2017, 94 (7), pp 941–945 DOI: 10.1021/acs.jchemed.6b00676 résumé de A.O. 2017-2018
3 Occurrences trouvées, Dernière modification:
plot_sinus_cosinusplugin-autotooltip__default plugin-autotooltip_bigGraphe simple de sinus et cosinus

On montre en détail comment réaliser une représentation graphique simple des fonctions sinus et cosinus. Au départ le graphique utilisera les réglages par défaut et la figure sera ensuite améliorée pas à pas en commentant les instructions matplotlib utilisées.
3 Occurrences trouvées, Dernière modification:
root-finding_algorithmplugin-autotooltip__default plugin-autotooltip_bigRoot findings : equations f(x) = 0

* Polynomial equations : Bairstow's method is an efficient algorithm for finding the roots of a real polynomial of arbitrary degree * Polynomials in NumPy * polynomial module, including polyroots(c) to compute the roots of a polynomial.

* Bisection method (dichotomy) : very simple and robust method, but relatively slow. It assumes continuity of the function, and obtain one roots. The algorithm is based on a
3 Occurrences trouvées, Dernière modification:
biblio-9780131493926-chap10plugin-autotooltip__default plugin-autotooltip_bigUne introduction à l'apprentissage en petits groupes

An Introduction to Small-Group Learning, Melanie M. Cooper, Department of Chemistry, Clemson University. chapitre 10 du “Chemists'guide to effective teaching”, Norbert J. Pienta, Melanie M. Cooper, Thomas J. Greenbowe, Pearson Prentice Hall 2005. Résumé de A.P., 2011-2012.
3 Occurrences trouvées, Dernière modification:
numpy_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de NumPy

NumPy est une extension du langage de programmation Python, destinée à manipuler des matrices ou tableaux multidimensionnels ainsi que des fonctions mathématiques opérant sur ces tableaux.

Numpy permet la manipulations des vecteurs, matrices et polynômes.
3 Occurrences trouvées, Dernière modification:
numerical_integrationplugin-autotooltip__default plugin-autotooltip_bigNumerical integration

Error estimation

* Equally spaced methods : * Numerical_integration * Trapezoidal_rule * Newton–Cotes_formulas * Simpson's rule and composite Simpson's rule

* If intervals between interpolation points vary : * Gaussian_quadrature

* Chapter 4 in the book “Numerical Recipes” : Integration of Functions * 4.0 Introduction * 4.1 Classical Formulas for Equally Spaced Abscissas
3 Occurrences trouvées, Dernière modification:
revision_cheat_sheetsplugin-autotooltip__default plugin-autotooltip_bigRevision & cheat sheets

Orphan page

* Revision sheet - revision sheets * Cheat sheet - cheat sheets



Cheat Sheets de G.I.T. Laboratory Journal

* Lien général : * The Analytical Balance * Cleaning Laboratory Glassware * Laboratory Burners (#3 2018, p11) * Freezing Mixtures for Everyday Laboratory Use (#1 2018, p12)


2 Occurrences trouvées, Dernière modification:
timeline-chimieplugin-autotooltip__default plugin-autotooltip_bigLigne du Temps de la Chimie


Toute science progresse par la réalisation et l'interprétation d'expériences, par l'introduction de nouveaux concepts, ... Des améliorations et corrections se succèdent alors, dévoilant parfois des erreurs ou des imprécisions du passé. Dans de nombreuses situations, la recherche scientifique induit des interrogations sur l'articulation des travaux actuels par rapport à la masse des connaissances précédentes. Dès lors, on se rend compte qu'une connaissanc…
2 Occurrences trouvées, Dernière modification:
stackexchange-chimieplugin-autotooltip__default plugin-autotooltip_bigQuestions et réponses en chimie sur chemistry.stackexchange

Chemistry Stack Exchange est un site de questions et réponses pour les scientifiques, les enseignants, les étudiants,... Il est gratuit, est son contenu est sous licence libre (copyleft) Creative Commons BY-SA. Aucune inscription n'est requise pour la consultation. Vous devez vous identifier pour y contribuer. Le fonctionnement est réglé par un système de
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed083p791plugin-autotooltip__default plugin-autotooltip_bigValence, nombre oxydation et charge formelle : Trois concepts liés mais fondamentalement différents

Valence, Oxidation Number, and Formal Charge: Three Related but Fundamentally Different Concepts De Gerard Parkin, J. Chem Ed. Vol. 83 No. 5 may 2006, pp 791-799) résumé de J.L., 2007-2008

Les termes de « valence » et d’ « oxydation » apparaissent fréquemment dans les textes à la fois élémentaires mais aussi avancés de la chimie. Cependant, il est évident à partir de la littérature que ces terme…
2 Occurrences trouvées, Dernière modification:
mapathon2018plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 24 mars 2018

Liens rapides :

* Présentation introductive générale du Mapathon du 24 mars 2018 ! * Les instructions pour faire de la carto humanitaire libre "HOT OSM" * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site * Tasking manager HOT (identifiez vous) * Choisissez un morceau de territoire à cartographier !
2 Occurrences trouvées, Dernière modification:
bioinformaticplugin-autotooltip__default plugin-autotooltip_bigBioinformatique

Manipulations de séquences ADN, ARN, protéines,...

Compter les nucléotides d'une séquence ADN

#!/usr/bin/env python # -*- coding: utf-8 -*- """ On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T') Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases """ adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

# utilisation d'une liste et de la méthode .count() base…
2 Occurrences trouvées, Dernière modification:
numerical_methods_for_ordinary_differential_equationsplugin-autotooltip__default plugin-autotooltip_bigIntegration of Ordinary Differential Equations

* Ordinary Differential Equations (ODE, ODEs) * Numerical methods for ordinary differential equations * Euler method * Runge-Kutta methods * « most widely known member of the Runge–Kutta family is generally referred to as “RK4”, “classical Runge–Kutta method” or simply as “the Runge–Kutta method »
2 Occurrences trouvées, Dernière modification:
mapathonplugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 25 mars 2020

FIXME : page pour l'édition 2020 en construction !!

Liens rapides :

* Présentation introductive générale du Mapathon 2020 * Les instructions pour faire de la carto humanitaire libre "HOT OSM" (source) * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule
2 Occurrences trouvées, Dernière modification:
server_lamp_installplugin-autotooltip__default plugin-autotooltip_bigInstallation d'un serveur LAMP

Le serveur sera installé dans une machine virtuelle (invitée) sous VirtualBox, avec la configuration de deux CMS (Wordpress et Dokuwiki) et d'outils pour la gestion de groupes de personnes ayant différents rôles :
2 Occurrences trouvées, Dernière modification:
biblio-10.1039-b812416gplugin-autotooltip__default plugin-autotooltip_bigLa chimie des chips

Learning chemistry and beyond with a lesson plan on potato crisps, which follows a socio-critical and problem-oriented approach to chemistry lessons, Ralf Marks, Stefanie Bertram and Ingo Eilks, Chem. Educ. Res. Pract., 2008, 9, 267-276. Sur base d'un résumé de A. V. V., AESS 2009-2010. (accès gratuit possible via le site de la RSC)

Le problème

L’article part d’une étude réalisée en Allemagne. Le constat est le même que partout ailleurs :
2 Occurrences trouvées, Dernière modification:
biblio-10.1039-b4rp90027hplugin-autotooltip__default plugin-autotooltip_bigLe laboratoire dans l'enseignement de la chimie : trente ans d'expérience avec des développements, de l'implémentation et de la recherche

The laboratory in chemistry education : thirty years of experience with developments, implementation, and research, Avi Hofstein, Chem. Educ. Res. Pract., 2004, 5, 247-264. Résumé de A.F., 2011-2012. Article d'intérêt didactique
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed100409pplugin-autotooltip__default plugin-autotooltip_bigCombien de temps les étudiants peuvent-ils prêter attention en classe ? Une étude de la baisse d’attention de l’étudiant en utilisant des clickers

How Long Can Students Pay Attention in Class? A Study of Student Attention Decline Using Clickers, D.M. Bunce, E.A. Flens and K.Y. Neiles, Journal of Chemical Education, 2010, 87(12), 1438-1443. Résumé de S.S., 2010-2011.
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed084p172plugin-autotooltip__default plugin-autotooltip_bigDeux types de problèmes conceptuels dans l’enseignement de la chimie

Two Kinds of Conceptual Problems in Chemistry Teaching + supplement, Zuzana Haláková and Miroslav Proksa, Journal of Chemical Education Vol. 84 No. 1 January 2007, p 172-174. Résumé de L.B., 2010-2011. Article d'intérêt didactique
2 Occurrences trouvées, Dernière modification:
notions_fondamentalesplugin-autotooltip__default plugin-autotooltip_bigNotions fondamentales

Aide mémoire synthétique sur le langage Python. Les différences importantes entre la branche 2 et la branche 3 seront commentées. La différence la plus fréquente est le passage de print à print() !

Règles de base

Ces règles peuvent être testées via le mode interactif de Python (en utilisant la fenêtre
2 Occurrences trouvées, Dernière modification:
physicochimie_1plugin-autotooltip__default plugin-autotooltip_bigPhysicoChimie I

Bachelier en sciences chimiques, deuxième année, 30 H cours et 30 H travaux pratiques, en co-suppléance avec P. Damman et S. Gabriele)

FIXME : contenus à ajouter sur la partie “phénomènes de transport”.


2 Occurrences trouvées, Dernière modification:
analyse_imagesplugin-autotooltip__default plugin-autotooltip_bigAnalyse d'images

Le traitement d'images permet de transformer des images. L'analyse d'images permet d'extraire des informations contenues dans une image. Il est aussi possible d'effectuer des tâches plus complexes de reconnaissance et d'analyse de scènes.
2 Occurrences trouvées, Dernière modification:
attracteur_lorenzplugin-autotooltip__default plugin-autotooltip_bigL'attracteur de Lorenz

L'attracteur de Lorenz est un système d'équations différentielles ordinaires au comportement particulier, chaotique. C'est un exemple classique de nombreux cours scientifiques, et plusieurs sites proposent des solutions.

Avec du code appliquant le méthode de Runge-Kutta d'ordre 4
1 Occurrences trouvées, Dernière modification:
elements_moleculesplugin-autotooltip__default plugin-autotooltip_bigÉléments et molécules

Les propriétés des éléments chimiques, de molécules peuvent être dressées, listées,... par un programme si on dispose des données. Celles-ci étant communes à tous les chimistes, et uniquement susceptibles de quelques modifications, il est utile de reprendre une source commune primaire (IUPAC) ou secondaire (comme Wikipedia) plutôt que de redéfinir toutes ces valeurs dans un programme.
1 Occurrences trouvées, Dernière modification:
anacondaplugin-autotooltip__default plugin-autotooltip_bigAnaconda

* Distribution python libre et multiplateforme (Windows, GNU/Linux, Mac OS), avec le système de Notebook web Jupyter en prime… Si les conditions sont limitées (matériel, réseau,…), il peut être plus intéressant d'installer la version
1 Occurrences trouvées, Dernière modification:
teaching_ressources_videosplugin-autotooltip__default plugin-autotooltip_bigRessources pour la création de séquences vidéos et l'enseignement à distance

Conseils généraux pour la conception

* conseils, longueurs, styles,... * Planifier, réaliser et diffuser des vidéos éducatives : lignes directrices et astuces pour les enseignants, Caroline Cormier, Edward Awad, Yann Brouillette et Véronique Turcotte (canada). Article reprenant des exemples de capsule en chimie (
1 Occurrences trouvées, Dernière modification:
progappchimplugin-autotooltip__default plugin-autotooltip_bigProgrammation appliquée à la chimie

Le cours “Programmation appliquée à la chimie” de bachelier en sciences chimiques (15 H cours et 15 H exercices, bloc2) utilise deux supports :

* Principalement, le présent wiki pour ses avantages techniques (coloration et indentation du code, recherche dans les pages, historique des modifications,
1 Occurrences trouvées, Dernière modification:
trisplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes de tri

Un algorithme de tri est, en informatique ou en mathématiques, un algorithme qui permet d'organiser une collection d'objets selon un ordre déterminé (Référence wikipedia).

Les tris sont intéressants du point de vue de l'apprentissage de l'algorithmique.
1 Occurrences trouvées, Dernière modification:
ebookplugin-autotooltip__default @wiki
1 Occurrences trouvées, Dernière modification:
aluminiumplugin-autotooltip__default plugin-autotooltip_bigAluminimum

FIXME : à compléter

* Aluminium et lave-vaisselle : c'est proscrit, l'eau de lavage étant basique ? vérifier, donner les réactions...

Activités diverses

* : “A possible activity with new y12s is to take a single chemical reaction and use this as a basis to explore chemistry they learned
1 Occurrences trouvées, Dernière modification:
config_ubuntuplugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un PC sous Ubuntu

Présentation générale de Ubuntu :

Configuration pour usage général et scientifique.

Ubuntu 16.04.1 LTS (i386 ou AMD64) Xenial Xerus


à suivre...

Ubuntu 14.04 LTS (i386 ou AMD64) Trusty Tahr

1 Occurrences trouvées, Dernière modification:
physicochimieplugin-autotooltip__default plugin-autotooltip_bigActivités d'enseignement en chimie-physique

Cours, exercices et stages :

* Thermodynamique (bachelier en sciences chimiques, deuxième année, 30 H cours, 30 H exercices et 30 H travaux pratiques, en co-suppléance avec P. Damman et S. Gabriele)
1 Occurrences trouvées, Dernière modification:
videos_chimie_sgplugin-autotooltip__default plugin-autotooltip_bigVidéos pour le cours de chimie sciences générales

Cette page reprend des références de vidéos utilisables dans un cours de chimie “Sciences générales”, suivant le programme du réseau officiel de la FWB. Ces vidéos sont évidemment tout aussi exploitables pour un autre cours de chimie (autre programme, sciences …
1 Occurrences trouvées, Dernière modification:
efficacite_energetique_transportplugin-autotooltip__default plugin-autotooltip_bigEfficacité énergétique des transports

Vocabulaire, généralités

* Metabolic cost of transport * Cost of transport * Efficacité énergétique dans les transports * Energy efficiency in transport * Animal locomotion * Exercise Physiology * Energy * Human Performance * nutritional efficiency


Humain :

* The mechanics and energetics of human walking and running: a joint level perspective Dominic James Farris and Gregory S. SawickiJ R Soc Interface. 2012 Jan 7; 9(66): …
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed400128xplugin-autotooltip__default plugin-autotooltip_bigSignification du concept de la mole pour les étudiants et les professeurs du secondaire

Unpacking the Meaning of the Mole Concept for Secondary School Teachers and Students Su-Chi Fang, Christina Hart, and David Clarke, J. Chem. Educ., 2014, 91 (3), pp 351–356 DOI: 10.1021/ed400128x résumé de J.V. 2014-2015

La mole est un concept fondamental en chimie quantitative, et pourtant des recherches ont démontré que l’apprentissage de ce concept était des plus difficiles. Cet article contient une re…
1 Occurrences trouvées, Dernière modification:
hcq-20200523plugin-autotooltip__default plugin-autotooltip_bigHCQ 23 mai 2020

* → fin de partie

⛔ Chloroquine à la Marseillaise : fin de partie ! ⛔

[⚠ Avertissement : ceci est un long article qui ne cherche pas à vous faire croire mais tentera d’expliquer et, en toute fin, de lister des ressources pour aller vérifier par vous-mêmes les données scientifiques et pas celle de Gérard, médecin épidémiologiste depuis 3 jours après formation Doctissimo ⚠]
1 Occurrences trouvées, Dernière modification:
pygal_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Pygal



* * Why use pygal?
1 Occurrences trouvées, Dernière modification:
bluetoothplugin-autotooltip__default plugin-autotooltip_bigBluetooth - astuces diverses

* Profils audio (casques, enceintes connectées,...) : * HSP (Headset Profile ou Profil casque) : offre les fonctionnalités de base pour établir la communication entre un combiné (le téléphone portable) et un casque.
1 Occurrences trouvées, Dernière modification:
arsenicplugin-autotooltip__default plugin-autotooltip_bigArsenic


* fr:Arsenic & Arsenic

L'arsenic a été fortement utilisé sous forme de sels comme pesticide en agriculture (Arséniate de plomb. En 1919, rien que la production mondiale d'arsenic était d'environ 20 000 tonnes ! (Source : Minerals Yearbook 1920, p60)
1 Occurrences trouvées, Dernière modification:
kirschner-how_learning_happensplugin-autotooltip__default plugin-autotooltip_bigHow learning happens - Comment l'apprentissage se fait

* Livre How Learning Happens - Seminal Works in Educational Psychology and What They Mean in Practice, 1st Edition, By Paul A. Kirschner, Carl Hendrick, Routledge 04/03/2020 ISBN: 9780367184575

1 Occurrences trouvées, Dernière modification:
polynomes-11plugin-autotooltip__default plugin-autotooltip_bigGraphe d'une famille de polynômes orthogonaux

Voici un programme permettant de visualiser les premiers polynômes orthogonaux de Tchebyshev :

#!/usr/bin/env python # -*- coding: utf-8 -*- """ graphes de Polynomes de Chebyschev """

from math import * from pylab import *

def polyeval(x,a): """ application de l'algorithme de Horner cf. """ n = len(a)-1 # n = ordre du polynome p = 0. for i in range(n,-1,-1): …
1 Occurrences trouvées, Dernière modification:
representation_molecules_2013plugin-autotooltip__default plugin-autotooltip_bigReprésentation de molécules

Page à actualiser...

Certaines fonctions de ce programme nécessite des fichiers de données : [base.csv] et [bdd.csv] #!/usr/bin/env python # -*- coding: UTF-8 -*- # travail de RL, ba2 chimie 2012-2013
1 Occurrences trouvées, Dernière modification:
fit_modele_einsteinplugin-autotooltip__default plugin-autotooltip_bigOptimisation de la température caractéristique du diamant suivant le modèle d'Einstein

Ce modèle prévoie la dépendance à la température de la capacité calorifique d’un solide cristallin.

La détermination de la température caractéristique nécessite de
1 Occurrences trouvées, Dernière modification:
grille_configurations_melange_binaire_2013plugin-autotooltip__default plugin-autotooltip_bigCréation d'une grille et de configurations d'un système binaire modélisé

#!/usr/bin/env python # -*- coding: utf-8 -*- # travail de ML et MP, ba2 chimie 2012-2013 # Création d'une grille et de configurations d'un système binaire modélisé
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed085p1372plugin-autotooltip__default plugin-autotooltip_bigEnseignement de l’hypothèse d’Avogadro en aidant les étudiants à voir le monde autrement

Teaching Avogadro's Hypothesis and Helping Students to See the World Differently Brett Criswell, J. Chem. Educ., 2008, 85 (10), p 1372 DOI: 10.1021/ed085p1372 Résumé de N.G., 2008-2009

L’auteur s’est intéressé aux travaux de monsieur Chi et de ses collaborateurs sur l’ontologie («étude de ce qui est réel et de ce qui ne l’est pas) et les fausses conceptions en sciences. Le modèle qui a été développé pour e…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021ed082p313plugin-autotooltip__default plugin-autotooltip_bigExpériences et réflexions à propos de l'enseignement de la structure atomique via une classe puzzle dans l'enseignement secondaire

Experiences and Reflections about Teaching Atomic Structure in a Jigsaw Classroom in Lower Secondary School Chemistry Lessons, Ingo Eilks, J. Chem. Ed. 82(2), pp 313-319,2005. Résumé de A.B. 2010-2011. Article d'intérêt didactique

1 Occurrences trouvées, Dernière modification:
biblio-_10.1039-c1rp90056kplugin-autotooltip__default plugin-autotooltip_bigUne étude de la compréhension des étudiants de chimie de première année (ens. sup.) sur la concentration des solutions

A study of first-year chemistry students’ understanding of solution concentration at the tertiary level, Kevin de Berg, Chem. Educ. Res. Pract., 2012, 13, 8-16. Résumé de A.P., 2011-2012. Article d'intérêt didactique

Les différents concepts en chimie sont souvent mal compris voir incompris, et provoquent chez les étudiants de nombreuses difficultés à réussir les cours de chim…
1 Occurrences trouvées, Dernière modification:
openbabel_jmolplugin-autotooltip__default plugin-autotooltip_bigOpenBabel et Jmol


OpenBabel est un ensemble de programme permettant de manipuler et convertir les fichiers de description de molécules dans différents formats.

* Site officiel : * Interfaçage en Python :

Pour utiliser OpenBabel en python, il faut installer au préalable ces outils. Sous Linux (Debian, Ubuntu,
1 Occurrences trouvées, Dernière modification:
potentiel_energy_surfaceplugin-autotooltip__default plugin-autotooltip_bigSurface d'énergie potentielle


Eyring et Polanyi ont publié en 1931 l'article On Simple Gas Reactions dans lequel ils décrivent les trajets des atomes dans la réaction + H --> H + (échange d'atomes). Ces travaux aboutiront au développement des notions de $E_{bond}= D_e [\exp(-2\beta(r-r_e))-2\exp(-\beta(r-r_e))]$$E_{ant}= \frac{D_e}{2} [\exp(-2\beta(r-r_e))+2\exp(-\beta(r-r_e))]$$r_e$$D_e$$\beta$$E_{bond}= \frac{Q_{AB}+\alpha_{AB}}{1+S^2_{AB}} = \frac{Q_{AB}+\alpha_{AB}}{1+k}$$E_{a…
1 Occurrences trouvées, Dernière modification:
ir_spectrum_coplugin-autotooltip__default plugin-autotooltip_bigSpectre IR du CO

Différentes techniques de spectroscopie utilisent des représentations standardisées des spectres. En spectroscopie Infrarouge, l'absorbance est traditionnellement représentée en fonction des nombres d'ondes décroissants exprimés en $cm^{-1}$. Pour rappel, en spectroscopie, le $\tilde{\nu}$$\tilde{\nu} = 1/\lambda = \nu/c$$\Delta J = \pm 1$$cm^{-1}$
1 Occurrences trouvées, Dernière modification:
csvplugin-autotooltip__default plugin-autotooltip_bigLire et écrire des fichiers de données csv

pandas Les fichiers csv sont des fichiers de données séparées par des virgules (ou point-virgules), pour “comma separated values”. Comme ceci :

1;0.1;3 2;0.3;5 3;0.5;7 4;0.6;11 5;0.9;21 6;1.5;39

Ils peuvent être facilement importés ou exportés de tableurs ou logiciels de graphiques scientifiques.
1 Occurrences trouvées, Dernière modification:
photonsplugin-autotooltip__default plugin-autotooltip_bigGaz de photons

Au XIXe siècle, le rayonnement lumineux a fait l'objet d'études :

* Loi de Wien (1896) * Loi de Rayleigh-Jeans (1900)

Les photons suivent les hypothèses suivantes :

* ils se déplacent à la vitesse de la lumière c dans le vide * sont des bosons * ont une masse nulle au repos$\nu$$h \nu$$h\nu /c$$h/ \lambda = \hbar \mathbf{k}$$\mathbf{k}$
1 Occurrences trouvées, Dernière modification:
cv_vibration_einsteinplugin-autotooltip__default plugin-autotooltip_bigComparaison microcanonique-canonique, vibrateurs et cristal d'Einstein

Les mesures de chaleur spécifique massique de quelques solides à température et pression ambiante (25 C et 1 atm) donnent ces résultats :

* Comment ramener ces valeurs à une base de comparaison commune ?
1 Occurrences trouvées, Dernière modification:
biblio-9780321611956-chap14plugin-autotooltip__default plugin-autotooltip_bigAnimations sur ordinateur de phénomènes chimiques à l'échelle moléculaire

Chemists' Guide to Effective Teaching, Volume II, Norbert J. Pienta, Melanie M. Cooper & Thomas J. Greenbowe, Prentice Hall, 2008, ISBN 9780321611956 - Chapter 14: Computer Animations of Chemical Processes at the Molecular Level (Résumé de S.P., 2013-2014)
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed100218zplugin-autotooltip__default plugin-autotooltip_bigComment introduire la notion d’aromaticité chimique ?

Discovering Chemical Aromaticity Using Fragrant Plants, T.L. Schneider, J.Chem.Educ. 2010, 87(8), 793-795. Résumé de D.F., 2010-2011

But de l’activité

Le but de cette activité est d’étudier la notion d’aromaticité chimique. Pour ce faire, le professeur a voulu mettre en place une situation permettant de relier la chimie organique à la vie quotidienne. Le challenge demandé aux étudiants est de choisir une plante odorante et d’identifier la …
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed300329eplugin-autotooltip__default plugin-autotooltip_bigChimie "on the go" : revue d'applications pour smartphone en chimie

Chemistry on the Go: Review of Chemistry Apps on Smartphones Diana Libman and Ling Huang, J. Chem. Educ., 2013, 90 (3), pp 320–325 DOI: 10.1021/ed300329e (résumé de D.D. 2014-2015)

De nos jours, quasi tous les jeunes ont un smartphone. De nombreuses applications mobiles ont alors vu le jour. Elles recouvrent un large éventail de fonctionnalités et disciplines. Les plus importantes, et presque toutes gratuites liées à la chimi…
1 Occurrences trouvées, Dernière modification:
entropie_configurationelle_simpleplugin-autotooltip__default plugin-autotooltip_bigExercices simples sur l'entropie configurationelle

* A partir de mesures expérimentales et de calculs théoriques, des chercheurs ont proposé pour borne inférieure de l'entropie d'un cristal d'éthylène la valeur $0~J~K^{-1}~\mbox{mol}^{-1}$ et ont montré qu'on pouvait obtenir une valeur arbitrairement proche de zéro pour un cristal d'éthylène.$CH_2CD_2$$5.763~ J\!K^{-1}\mbox{mol}^{-1}$$CH_2CD_2$$CH_2CD_2$$CD_2CH_2$$0~J~K^{-1}~\mbox{mol}^{-1}$$CH_3D$$11.526~J~K^{-1}~\mbox{mol}^{-1}$$A$$B$$C$$A,…
1 Occurrences trouvées, Dernière modification:
entropie_melangeplugin-autotooltip__default plugin-autotooltip_bigEntropie de mélange pour un gaz ou liquide idéal

#! /usr/bin/env python # -*- coding: utf-8 -*- “”“ représentation graphique de l'entropie de mélange d'un système idéal ”“”

import numpy as np # voir
1 Occurrences trouvées, Dernière modification:
ebook_helpplugin-autotooltip__default plugin-autotooltip_bigCréation d'un ebook

Dès que vous avez utilisé l'icône de la barre latérale “Ajouter au livre”, vous aurez en tête de chaque page disponible un bandeau vous donnant accès à un créateur de livre. Vous pouvez facilement ajouter ou enlever toute page (comme avec l'icône du bandeau latéral), vous rendre vers le gestionnaire pour
1 Occurrences trouvées, Dernière modification:
biblio-didactique-chimieplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes en didactique de la chimie, mais pas seulement

La plupart des résumés de publications sont issus d'analyses d'articles effectuées par des étudiants dans le cadre des études d'AESS en chimie ou de bacheliers/masters en chimie (les initiales et années sont alors indiquées), pour des publications souvent issues de cette
1 Occurrences trouvées, Dernière modification:
eigenvalues_and_eigenvectorsplugin-autotooltip__default plugin-autotooltip_bigEigenvalues and eigenvectors

* Eigenvalues and eigenvectors * Important matrix properties * Hermitian, orthogonality,...

* Eigenvalue algorithm * Power iteration, a simple numerical algorithm producing a number $\lambda$, the greatest (in absolute value) eigenvalue of a matrix $A$, and the corresponding eigenvector $v$$Av=\lambda v$
1 Occurrences trouvées, Dernière modification:
biblio-10.1039-b5rp90014jplugin-autotooltip__default plugin-autotooltip_bigCompréhension par les élèves des titrages et des phénomènes acide-base reliés

High school students’ understanding of titrations and related acid-base phenomena, K. Sheppard, Chemistry Education Research and Practice, 2006, 7 (1), 32-45. Résumé de A.F., 2011-2012.

L’auteur, K. Sheppard, a voulu mettre en avant les problèmes qui causent l’incompréhension des étudiants face aux phénomènes acide-base qui régissent les titrages. Les causes mises en avant par l’auteur sont l’incompréhension par les …
1 Occurrences trouvées, Dernière modification:
factorielle-4plugin-autotooltip__default plugin-autotooltip_bigFactorielle : travaux additionnels

Idées d'exercices complémentaires, d'applications.

Utilisation d'un dictionnaire

Il peut être intéressant de précalculer des factorielles qui seront mémorisées dans un dictionnaire.

Comparaison avec l'approximation de Stirling
1 Occurrences trouvées, Dernière modification:
pip-pypiplugin-autotooltip__default plugin-autotooltip_bigInstaller facilement des modules python

AnacaondaPythonxy ...


Des modules additionnels de Python peuvent être installés via des sites qui les proposent. Il s'agit de :

* créateurs de programmes, librairies * firmes ou associations qui proposent des ensembles cohérents (comme
1 Occurrences trouvées, Dernière modification:
ubuntuplugin-autotooltip__default plugin-autotooltip_bigUbuntu

Ceci est une page en construction destinée à faire partager mon expérience personnelle de Ubuntu, une distribution très populaire de Linux !

Liens principaux

* , le site officiel * site francophone non officiel * (site des utilisateurs francophones et
1 Occurrences trouvées, Dernière modification:
  • start.txt
  • Dernière modification: 2020/10/02 14:58
  • de villersd