Outils pour utilisateurs

Outils du site


teaching:progappchim:dictionary_adn_protein

Traduction de l'ADN en séquence d'acides aminés

#!/usr/bin/env python
# -*- coding: iso-8859-1 -*-

# python code to translante DNA sequences into proteins
# traduction de l'ADN en séquence d'acides aminés (protéine)

def translate_dna(sequence):    # to translate a DNA sequence in equivalent protein
    # see http://fr.wikipedia.org/wiki/Code_g%C3%A9n%C3%A9tique
    # http://en.wikipedia.org/wiki/Genetic_code
    gencode = {                   # définition d'un dictionnaire dont chaque clé (un codon de 3 nucléotides) donne l'acide aminé correpondant
    'ATA':'I', 'ATC':'I', 'ATT':'I', 'ATG':'M',  
    'ACA':'T', 'ACC':'T', 'ACG':'T', 'ACT':'T',  
    'AAC':'N', 'AAT':'N', 'AAA':'K', 'AAG':'K',  
    'AGC':'S', 'AGT':'S', 'AGA':'R', 'AGG':'R',  
    'CTA':'L', 'CTC':'L', 'CTG':'L', 'CTT':'L',  
    'CCA':'P', 'CCC':'P', 'CCG':'P', 'CCT':'P',  
    'CAC':'H', 'CAT':'H', 'CAA':'Q', 'CAG':'Q',  
    'CGA':'R', 'CGC':'R', 'CGG':'R', 'CGT':'R',  
    'GTA':'V', 'GTC':'V', 'GTG':'V', 'GTT':'V',  
    'GCA':'A', 'GCC':'A', 'GCG':'A', 'GCT':'A',  
    'GAC':'D', 'GAT':'D', 'GAA':'E', 'GAG':'E',  
    'GGA':'G', 'GGC':'G', 'GGG':'G', 'GGT':'G',  
    'TCA':'S', 'TCC':'S', 'TCG':'S', 'TCT':'S',  
    'TTC':'F', 'TTT':'F', 'TTA':'L', 'TTG':'L',  
    'TAC':'Y', 'TAT':'Y', 'TAA':'_', 'TAG':'_',  
    'TGC':'C', 'TGT':'C', 'TGA':'_', 'TGG':'W',
    }
    print sequence  
    proteinseq = ''  
    for n in range(0,len(sequence),3):  
        if gencode.has_key(sequence[n:n+3]) == True:  # check that key exists in dictionary
            proteinseq += gencode[sequence[n:n+3]]  
    return proteinseq


#  DNA sequences : GenBank : http://www.ncbi.nlm.nih.gov/

se='GTGACTTTGTTCAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGTAATCACTTGTTCTTTAAATAAGGACTAGTATGAATGGCATCACGAGGGCTTTACTGTCTCCTTTTTCTAATCAGTGAA'
#se='GTGACTTTG'
print len(se)
print translate_dna(se)

# extensions : lire la séquence à partir d'un fichier
# générer des mutations aléatoires de l'ADN et examiner les modifications éventuelles de la protéine
# faire correspondre des noms complets ou abbréviations sur 3 lettres des acides aminés
# générer l'ARN correspondant

références

Ce site web utilise des cookies pour analyser le trafic de visites. En restant sur ce site, vous acceptez le stockage de cookies sur votre ordinateur. En savoir plus
teaching/progappchim/dictionary_adn_protein.txt · Dernière modification: 2012/11/30 13:28 par villersd