

Voici les résultats de votre recherche.

  • test (teaching)plugin-autotooltip__default plugin-autotooltip_bigtest

  • t-test (teaching:progappchim)plugin-autotooltip__default plugin-autotooltip_bigTest de Student

    Le test de Student (t-test) teste statistiquement l’hypothèse d’égalité de l'espérance de deux variables aléatoires suivant une loi normale et de variance inconnue.


    * (des exemples simples) * Documentation Python sur stats de scipy * 1-sample t-test * Unpaired t-test * Paired t-test
  • testjs (teaching:progappchim)plugin-autotooltip__default plugin-autotooltip_bigTest Javascript + dokuwiki + DataCamp-light

psychologie_de_l_educationplugin-autotooltip__default plugin-autotooltip_bigPsychologie de l'éducation

Thèmatiques reliées : neurosciences, cognition/métacognition, motivation,...

Principes fondamentaux

* Comment pensent et apprennent les élèves ? * PRINCIPE 1 - Les convictions et perceptions de l’élève sur son intelligence et ses aptitudes influencent son mode de fonctionnement cognitif et son apprentissage.
74 Occurrences trouvées, Dernière modification:
ns la salle de classe! Lorsque vous développez un test, utilisez un nombre suffisant de questions et cho... at participants scoring in the bottom quartile on tests of humor, grammar, and logic grossly overestimated their test performance and ability. Although their test scores put them in the 12th percentile, they estimated the
desinformationsplugin-autotooltip__default plugin-autotooltip_bigDes informations ou désinformations ?

Cette page regroupe quelques exemples d'informations et désinformations, notamment tirés de différents media : presse, réseaux sociaux, blogs, forums,... des désinformations, et parfois aussi une information qui se veut plus conforme aux faits.
58 Occurrences trouvées, Dernière modification:
United States, France and Germany, and in a study testing attitudes about a medical application of genet...|Glyphosate dans les urines. Des tests à la fiabilité contestée © Le Télégramme https:/
articles_didactique_chimieplugin-autotooltip__default plugin-autotooltip_bigSélection d'articles en didactique de la chimie

Liens rapides :

* : numéro courant de Journal of Chemical Education où vous avez la possibilité de consulter les résumés. Si vous souhaitez recevoir la table des matières à chaque nouveau numéro, il vous suffit de prendre l'option
19 Occurrences trouvées, Dernière modification:
1021/acs.jchemed.7b00594|Development of the Flame Test Concept Inventory: Measuring Student Thinking abo... tudent Performance Using Computer and Paper-Based Tests: Results from Two Studies in General Chemistry]]... d.7b00040|Another Twist of the Foam: An Effective Test Considering a Quantitative Approach to “Elephant’... hone Colorimetry: A New Method for an Established Test]] Clifford T. Gee, Eric Kehoe, William C. K. Pome
bokeh_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Bokeh, une librairie pour des visualisations interactives dans un navigateur web

* page d'entrée sur Bokeh * User guide * Galerie d'exemples * Bokeh dans les Jupyter notebooks * Bokeh tutorial in live Jupyter Notebooks * Reference guide

* Réseaux sociaux : * Twitter * GitHub * Youtube

Exemples scientifiques

* Interactions sur la fonction sinus (amplitude, décalage vertical, fréquence, déphasage) +
18 Occurrences trouvées, Dernière modification:
r web ====== * [[|page d'entrée sur Bokeh]] * [[|User guide]] * [[|Galerie d'exemples]] * [[ht... Notebooks]] * [[|Reference guide]] * Réseaux
notions_fondamentalesplugin-autotooltip__default plugin-autotooltip_bigNotions fondamentales

Aide mémoire synthétique sur le langage Python. Les différences importantes entre la branche 2 et la branche 3 seront commentées. La différence la plus fréquente est le passage de print à print() !

Règles de base

Ces règles peuvent être testées via le mode interactif de Python (en utilisant la fenêtre
12 Occurrences trouvées, Dernière modification:
=== Règles de base ===== Ces règles peuvent être testées via le mode interactif de Python (en utilisant... tion officielle]] ou [[|cet autre cours]] avec des illustrations et... bloc d'instruction en rapport avec les conditions testées, dont la valeur est évaluée comme "vrai" (true...]] (Python 2) * [[
biblio-10.1021-ed083p954plugin-autotooltip__default plugin-autotooltip_bigFausse conceptions à propos de la nature particulaire de la matière. Utiliser des animations pour combler l'écart entre les genres

Misconceptions about the Particulate Nature of Matter. Using Animations To Close the Gender Gap, Ellen J. Yezierski, James P. Birk, J. Chem. Educ., 2006, 83 (6), p 954 DOI: 10.1021/ed083p954. Résumé X.V., 2012-2013.
12 Occurrences trouvées, Dernière modification:
nt" (ParNoMA) a été utilisé comme un pré- et post-test pour mesurer la compréhension conceptuelle des ét... er leurs scores sur le ParNoMA. Les scores au pré-test pour les étudiants de sexe masculin étaient signi... ux des élèves de sexe féminin; les scores au post-test pour les étudiants qui ont consulté les animation... des animations semblait améliorer les scores post-test des étudiantes, et comblait l'écart entre les gen
t-testplugin-autotooltip__default plugin-autotooltip_bigTest de Student

Le test de Student (t-test) teste statistiquement l’hypothèse d’égalité de l'espérance de deux variables aléatoires suivant une loi normale et de variance inconnue.


* (des exemples simples) * Documentation Python sur stats de scipy * 1-sample t-test * Unpaired t-test * Paired t-test
12 Occurrences trouvées, Dernière modification:
====== Test de Student ====== Le [[|test de Student]] (t-test) teste statistiquement l’hypothèse d’égalité de l'espérance de deux variables aléa
initinfoplugin-autotooltip__default plugin-autotooltip_bigInitiation à l'informatique

Cours libre en ligne à destination des étudiants de la section chimie. Si vous avez des questions ou souhaits de compléments d'informations, ou d'ajouts de rubriques, vous pouvez utiliser ce formulaire de contact.

Les bases de l'informatique
10 Occurrences trouvées, Dernière modification:]] et [[]]. [[|Firefox send]] ... s. La carte d'étudiant est à validé annuelle et atteste le fait que l'étudiant est en ordre administrati... e disque dur (windows en général). Vous pouvez le tester, mais vous ne pourrez pas sauvegarder vos donné... eur de texte. Générer des longs textes en vue de tester des fonctionnalités : 2 solutions simples sont
biblio-10.1039-c0rp90006kplugin-autotooltip__default plugin-autotooltip_bigLes animations peuvent-elles remplacer les méthodes traditionnelles d’enseignement?

Partie I - préparation et tests

Can animations effectively substitute for traditional teaching methods? Part I: preparation and testing of materials Roberto Ma. Gregorius, Rhodora Santos, Judith B. Dano and Jose J. Gutierrez Chem. Educ. Res. Pract., 2010,11, 253-261 DOI: 10.1039/C0RP90006K Résumé de E.V., 2011-2012
9 Occurrences trouvées, Dernière modification:
eignement? ====== ===== Partie I - préparation et tests ===== [[ itional teaching methods? Part I: preparation and testing of materials]] Roberto Ma. Gregorius, Rhodora... ux groupes qu’on peut qualifier d’équivalent (des tests préalables ayant été réalisés). Tout a été super... s pour les deux groupes. Toutes les questions des tests concordent avec le « programme » du Texas et son
biblio-10.1021-acs.jchemed.5b01010plugin-autotooltip__default plugin-autotooltip_bigEfficacité des leçons basées sur la recherche utilisant les modèles au niveau particulaire pour développer la compréhension conceptuelle de la Stœchiométrie par les élèves du secondaire

Article Effectiveness of Inquiry-Based Lessons Using Particulate Level Models To Develop High School Students’ Understanding of Conceptual Stoichiometry, Stephanie Kimberlin and Ellen Yezierski, J. Chem. Educ., 2016, 93 (6), pp 1002–1009 DOI: 10.1021/acs.jchemed.5b01010 résumé de A.H. 2016-2017
9 Occurrences trouvées, Dernière modification:
été utilisée, avec la conception d’un groupe pré-test post-test. L’intervention a engagé des étudiants dans des activités basées sur des enquêtes avec divers... ssance significative d’effets considérables du prétest au posttest démontre que l’intervention a amélioré la compréhension conceptuelle des élèves. En effet,
images_chimie_libresplugin-autotooltip__default plugin-autotooltip_bigImages libres en chimie

* N'oubliez pas de respecter les licences (sauf domaine public ou licence CC-zero), cf. les explications à la page Ressources éducatives libres. Voir en particulier les sources mentionnées ici : Images libres * Plutôt que de copier l'image, surfez vers le lien afin de sélectionner la résolution qui vous convient
8 Occurrences trouvées, Dernière modification:
ttps:// * [[wp>Flame_test|Flame test]] et [[wp>fr:Test_de_flamme|Test de flamme]] avec des images de flammes pour quelques éléments * Sélections et images d
factorielle-3plugin-autotooltip__default plugin-autotooltip_bigFactorielle : une fonction en Python

Voici une version avec la fonction factorielle()

#! /usr/bin/env python # -*- coding: utf-8 -*- """ Calcul de la factorielle d'un nombre Référence : """ def factorielle(arg_n): """ structure de répétition pour appliquer la définition de la factorielle """ reponse = 1 # la réponse sera dans la variable reponse i = 1 # on va commencer par 1 while i <= arg_n: …
8 Occurrences trouvées, Dernière modification:
factorielle d'un nombre naturel, et vous pourrez tester que sur un argument négatif ou non-entier, math
stackexchange-chimieplugin-autotooltip__default plugin-autotooltip_bigQuestions et réponses en chimie sur chemistry.stackexchange

Chemistry Stack Exchange est un site de questions et réponses pour les scientifiques, les enseignants, les étudiants,... Il est gratuit, est son contenu est sous licence libre (copyleft) Creative Commons BY-SA. Aucune inscription n'est requise pour la consultation. Vous devez vous identifier pour y contribuer. Le fonctionnement est réglé par un système de
7 Occurrences trouvées, Dernière modification:|Flame Test Spectrograms Not Lining Up With Reality]] * [[http... oes-the-top-of-wick-glow-if-bottom-of-flame-is-hottest|When a candle burns, why does the top of wick glow if bottom of flame is hottest?]] * [[
algos_entiersplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes sur entiers

cf....... Cette page reprend quelques grands algorithmes classiques sur les nombres entiers, et introduit quelques algorithmes ayant des applications en chimie.

Recherche du PGCD (plus grand commun diviseur)

Explication géométrique : en comprenant un nombre entier comme une longueur et un couple d'entiers (a,b) comme un rectangle, leur PGCD est la longueur du côté du plus grand carré permettant de carreler entièrement ce rectangle. L'algorithme d'Euclide décompose ce re…
7 Occurrences trouvées, Dernière modification:
UTF-8 -*- def gcd(a, b): """Calculate the Greatest Common Divisor of a and b. Unless b==0, the ...]] * [[https://docs.pyt... à un nombre N donné, un algorithme naïf (appelés tests de primalité) consiste à considérer les naturels... mbre n'est pas divisible par 2, il est inutile de tester s'il est divisible par 4. En fait, il suffit de
biblio-10.1333-s00897040769aplugin-autotooltip__default plugin-autotooltip_bigDes équilibres acide-base

* Des équilibres acide-base, Partie 1. Les conceptions et les difficultés les plus importantes des étudiants du secondaire - Acid-base Equilibria, Part I. Upper Secondary Students’ Misconceptions and Difficulties, DEMEROUTI M., KOUSATHANA M, TSAPARLIS G., Chemical Educator, 2004, 9, pp 122-131 * Des équilibres acide-base, partie 2. Effets du niveau de développement mental et du style cognitif sur la compréhension conceptuelle et la capacité de résolution des problè…
7 Occurrences trouvées, Dernière modification:
fficient α de Cronbach ». Le questionnaire et le test ont été administrés à 119 étudiants de pré-univer... s étudiants a été estimé à partir des moyennes au Test du raisonnement formel. Les moyennes de « papier-... on » de Lawson dans le qcm dans sa forme révisée (test de raisonnement scientifique). Seuls 13 items conformes étaient concernés par ce test. Un point a été accordé lorsque la réponse et l’e
biblio-10.1021-ed400091wplugin-autotooltip__default plugin-autotooltip_bigUne méthode efficace pour présenter le tableau périodique comme un jeu de mots croisés au niveau secondaire

Article An Effective Method of Introducing the Periodic Table as a Crossword Puzzle at the High School Level Sushama D. Joag, J. Chem. Educ., 2014, 91 (6), pp 864–867 DOI: 10.1021/ed400091w résumé de J.-L.D. 2016-2017

L’article présente une nouvelle méthode d’apprentissage pour introduire le tableau périodique aux élèves du secondaire. Le public essentiellement visé est celui des ado…
7 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00676plugin-autotooltip__default plugin-autotooltip_bigQuantification des concentrations de protéines à l'aide de la colorimétrie par un Smartphone: une nouvelle méthode pour un test établi

Article: Quantifying Protein Concentrations Using Smartphone Colorimetry: A New Method for an Established Test T. Gee, Eric Kehoe, William C. K. Pomerantz, and R. Lee Penn, J. Chem. Educ., 2017, 94 (7), pp 941–945 DOI: 10.1021/acs.jchemed.6b00676 résumé de A.O. 2017-2018
6 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00891plugin-autotooltip__default plugin-autotooltip_bigDétermination de l'acidité titrable dans le vin à l'aide de méthodes potentiométriques, conductimétriques et photométriques

Article : Determination of Titratable Acidity in Wine Using Potentiometric, Conductometric, and Photometric Methods Dietrich A. Volmer, Luana Curbani, Timothy A. Parker, Jennifer Garcia, Linda D. Schultz, and Endler Marcel Borges, J. Chem. Educ., 2017, 94 (9), pp 1296–1302 DOI: 10.1021/acs.jchemed.6b00891 résumé de J.D. 2017-2018
5 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b00164plugin-autotooltip__default plugin-autotooltip_bigExploration du contexte quotidien des éléments chimiques : Découvrir les éléments des composants automobiles

Article Exploring the Everyday Context of Chemical Elements: Discovering the Elements of Car Components Antonio Joaquín Franco-Mariscal, J. Chem. Educ., 2015, 92 (10), pp 1672–1677 DOI: 10.1021/acs.jchemed.5b00164 résumé de L.R. 2016-2017
5 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed084p172plugin-autotooltip__default plugin-autotooltip_bigDeux types de problèmes conceptuels dans l’enseignement de la chimie

Two Kinds of Conceptual Problems in Chemistry Teaching + supplement, Zuzana Haláková and Miroslav Proksa, Journal of Chemical Education Vol. 84 No. 1 January 2007, p 172-174. Résumé de L.B., 2010-2011. Article d'intérêt didactique
5 Occurrences trouvées, Dernière modification:
biblio-10.1016-j.chb.2015.08.038plugin-autotooltip__default plugin-autotooltip_bigL'efficacité des exemples résolus par rapport aux exemples erronés, à la résolution de problèmes avec tutorat et à la résolution de problèmes dans des environnements d'apprentissage basés sur ordinateur

The efficiency of worked examples compared to erroneous examples, tutored problem solving, and problem solving in computer-based learning environments Bruce M. McLaren, Tamara van Gog, Craig Ganoe, Michael Karabinos, David Yaron, Computers in Human Behavior Volume 55, Part A, February 2016, Page…
5 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00226plugin-autotooltip__default plugin-autotooltip_bigLe tableau périodique des personnes: Un cadre pour engager les étudiants d'introduction à la chimie

Article The People Periodic Table: A Framework for Engaging Introductory Chemistry Students Adam Hoffman and Mark Hennessy, J. Chem. Educ., 2018, 95 (2), pp 281–285 DOI: 10.1021/acs.jchemed.7b00226 résumé de A.-C. N. 2018-2019
5 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00261plugin-autotooltip__default plugin-autotooltip_bigDéveloppement d’un test à trois niveaux comme outil de diagnostic valide pour l’identification de fausses conceptions sur les glucides

Article Development of a Three-Tier Test as a Valid Diagnostic Tool for Identification of Misconceptions Related to Carbohydrates, Dušica D. Milenković, Tamara N. Hrin, Mirjana D. Segedinac, and Saša Horvat, J. Chem. Educ., 2016, 93 (9), pp 1514–1520 DOI: 10.1021/acs.jchemed.6b00261 résumé de H.D. 2016-2017
5 Occurrences trouvées, Dernière modification:
pavage_penrose_2013plugin-autotooltip__default plugin-autotooltip_bigPavage de Penrose

#!/usr/bin/env python # -*- coding: utf-8 -*- # réference : # version un peu aménagée du travail de EC et LP, ba2 chimie 2012-2013

import math import cmath import cairo

# definir le nombre d'or goldenRatio = (1 + math.sqrt(5)) / 2
5 Occurrences trouvées, Dernière modification:
teaching_ressources_videosplugin-autotooltip__default plugin-autotooltip_bigRessources pour la création de séquences vidéos et l'enseignement à distance

Conseils généraux pour la conception

* conseils, longueurs, styles,... * Planifier, réaliser et diffuser des vidéos éducatives : lignes directrices et astuces pour les enseignants, Caroline Cormier, Edward Awad, Yann Brouillette et Véronique Turcotte (canada). Article reprenant des exemples de capsule en chimie
5 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed400851mplugin-autotooltip__default plugin-autotooltip_bigIntégration de senseurs en papier à base de nanoparticules : un exemple d’application pour une analyse colorimétrique rapide d’antioxydants

Article Integration of Nanoparticle-Based Paper Sensors into the Classroom: An Example of Application for Rapid Colorimetric Analysis of Antioxidants Erica Sharpe and Silvana Andreescu, J. Chem. Educ., 2015, 92 (5), pp 886–891 DOI: 10.1021/ed400851m résumé de G.D. 2015-2016
4 Occurrences trouvées, Dernière modification:
timeline-chimieplugin-autotooltip__default plugin-autotooltip_bigLigne du Temps de la Chimie


Toute science progresse par la réalisation et l'interprétation d'expériences, par l'introduction de nouveaux concepts, ... Des améliorations et corrections se succèdent alors, dévoilant parfois des erreurs ou des imprécisions du passé. Dans de nombreuses situations, la recherche scientifique induit des interrogations sur l'articulation des travaux actuels par rapport à la masse des connaissances précédentes. Dès lors, on se rend compte qu'une connaissanc…
4 Occurrences trouvées, Dernière modification:
testjsplugin-autotooltip__default plugin-autotooltip_bigTest Javascript + dokuwiki + DataCamp-light

4 Occurrences trouvées, Dernière modification:
grille_configurations_melange_binaire_2013plugin-autotooltip__default plugin-autotooltip_bigCréation d'une grille et de configurations d'un système binaire modélisé

#!/usr/bin/env python # -*- coding: utf-8 -*- # travail de ML et MP, ba2 chimie 2012-2013 # Création d'une grille et de configurations d'un système binaire modélisé
4 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00849plugin-autotooltip__default plugin-autotooltip_bigTouchez vite! Jouer à un jeu de symétrie moléculaire pour une évaluation pratique et formative de la compréhension des concepts de symétrie par les étudiants

Article : Tap It Fast! Playing a Molecular Symmetry Game for Practice and Formative Assessment of Students’ Understanding of Symmetry Concepts Ricardo Dagnoni Huelsmann, Andrei Felipe Vailati, Lucas Ribeiro de Laia, Patrícia Salvador Tessaro, and Fernando Roberto Xavier, J. Chem. Educ., 2018, 95 (7), pp 1151–1155 DOI: 10.1021/acs.jchemed.7…
4 Occurrences trouvées, Dernière modification:
bioinformaticplugin-autotooltip__default plugin-autotooltip_bigBioinformatique

Manipulations de séquences ADN, ARN, protéines,...

Compter les nucléotides d'une séquence ADN

#!/usr/bin/env python # -*- coding: utf-8 -*- """ On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T') Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases """ adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

# utilisation d'une liste et de la méthode .count() base…
3 Occurrences trouvées, Dernière modification:
biblio-didactique-chimieplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes en didactique de la chimie, mais pas seulement

La plupart des résumés de publications sont issus d'analyses d'articles effectuées par des étudiants dans le cadre des études d'AESS en chimie ou de bacheliers/masters en chimie (les initiales et années sont alors indiquées), pour des publications souvent issues de cette
3 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b00203plugin-autotooltip__default plugin-autotooltip_bigPourquoi demander pourquoi ?

Article : Why Ask Why? Melanie M. Cooper, J. Chem. Educ., 2015, 92 (8), pp 1273–1279 DOI: 10.1021/acs.jchemed.5b00203 résumé de C.M. 2015-20162015-2016


Dans cet article, l’auteur dit qu’il est important d’aider les étudiants à construire des explications mécanistiques et causales des phénomènes, c’est-à-dire, aider les étudiants à utiliser leur compréhension des interactions au niveau moléculaire afin d’expliquer et prédire les événements se produisant au …
3 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed3004462plugin-autotooltip__default plugin-autotooltip_bigDoigts les plus rapides: un jeu de construction de molécules pour l'enseignement de la chimie organique

Fastest Fingers: A Molecule-Building Game for Teaching Organic Chemistry Michael L. Eastwood, J. Chem. Educ., 2013, 90 (8), pp 1038–1041 DOI: 10.1021/ed3004462 Résumé de T.F. 2013-2014

Enseigner la chimie organique à des élèves débutants n’est pas une chose facile. En tant que des futurs enseignants, nous serons confronté à ce genre de situation et il nous reviendra de droit d’apporter que…
3 Occurrences trouvées, Dernière modification:
hcq-20200523plugin-autotooltip__default plugin-autotooltip_bigHCQ 23 mai 2020

* → fin de partie

⛔ Chloroquine à la Marseillaise : fin de partie ! ⛔

[⚠ Avertissement : ceci est un long article qui ne cherche pas à vous faire croire mais tentera d’expliquer et, en toute fin, de lister des ressources pour aller vérifier par vous-mêmes les données scientifiques et pas celle de Gérard, médecin épidémiologiste depuis 3 jours après formation Doctissimo ⚠]
3 Occurrences trouvées, Dernière modification:
rappels-proba-statplugin-autotooltip__default plugin-autotooltip_bigRappels de probabilités et statistique + quelques applications

Évènements, probabilités : définitions

* Épreuve ou expérience aléatoire : processus dont le résultat est incertain (tirage au hasard , jets de pièces, de dès,...) * Évènement$\Omega$$E_i$$p(E_i)$$0
3 Occurrences trouvées, Dernière modification:
methcalchimplugin-autotooltip__default plugin-autotooltip_bigCalculation methods applied to chemistry

Synopsis (english)

Mathematical prerequisites

Programming bases and tools

* Python programming language * interactive tutorial with code execution * DataCamp free course "Intro to Python for Data Science" * Python 3 Tutorial, interactive, with code use in web browser * MOOCs (massive open online courses) :
3 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00711plugin-autotooltip__default plugin-autotooltip_bigLes solutions aqueuses d'anions amphiprotiques sont elles acides, basiques, ou neutres ?

Article : Are Aqueous Solutions of Amphiprotic Anions Acidic, Basic, or Neutral? A Demonstration with Common pH Indicators Jervee M. Punzalan and Voltaire G. Organo, J. Chem. Educ., 2017, 94 (7), pp 911–915 DOI: 10.1021/acs.jchemed.6b00711 résumé de V.L. 2017-2018
3 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed086p1433plugin-autotooltip__default plugin-autotooltip_bigMettre l’accent sur la représentation à plusieurs niveaux afin d’augmenter la compréhension des étudiants concernant les changements se produisant durant des réactions chimiques

Emphasizing Multiple Levels of Representation To Enhance Students'Understandings of the Changes Occuring during Chemical Reactions, A.L. Chandrasegaran and David F. Treagust, J. Chem. Educ. December 2009 vol. 86 N°12, 1433-1436. Résumé de T.D., 2009-2010.
3 Occurrences trouvées, Dernière modification:
polynomes-10plugin-autotooltip__default plugin-autotooltip_bigPolynômes : fonctionnalités supplémentaires

Voici quelques fonctions utiles pour manipuler les polynômes :


Proposé et testé par RL, étudiant ba2 2012-2013.

#!/usr/bin/env python # -*- coding: utf-8 -*- def polyderiv(a): """ dérivation d'un polynôme """ b = a[:] #copie de la liste des coefficients du polynôme de départ n = len(b) -1 #ordre du polynôme for i in range (n+1): b[i] = b[i] * i #on redéfinit chaque coefficient i de la liste par ce…
3 Occurrences trouvées, Dernière modification:
notions_avanceesplugin-autotooltip__default plugin-autotooltip_bigNotions avancées

En construction. Les liens sont juste donnés. Une introduction et un exemple devrait être proposé pour chaque rubrique, et le nombre de ces rubriques augmenté.


Générateurs et "yield"

* * * *
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed4003578plugin-autotooltip__default plugin-autotooltip_bigLes perceptions des élèves concernant l'utilisation de jeux éducatifs comme outil pour enseigner le tableau périodique des éléments au niveau secondaire

Articles Students’ Perceptions about the Use of Educational Games as a Tool for Teaching the Periodic Table of Elements at the High School Level Antonio Joaquín Franco-Mariscal, José María Oliva-Martínez, and M. L. Almoraima Gil, J. Chem. Educ., 2015, 92 (2), pp 278–285 DOI: 10.1021/ed4003578 résumé de G.V. 2015-2016
2 Occurrences trouvées, Dernière modification:
matplotlib_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Matplotlib, une librairie pour réaliser des graphiques 2D

Matplotlib est une bibliothèque très puissante du langage de programmation Python destinée à tracer et visualiser des données sous formes de graphiques. Elle est souvent combinée avec les bibliothèques python de calcul scientifique :
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00404plugin-autotooltip__default plugin-autotooltip_bigExploration des substances mystérieuses, X et Y: remettre en question l’opinion des étudiants sur la chimie acide-base et l’équilibre chimique

Article Exploring the Mysterious Substances, X and Y: Challenging Students’ Thinking on Acid–Base Chemistry and Chemical Equilibrium Ingo Eilks, Ozcan Gulacar, and Jose Sandoval, J. Chem. Educ., 2018, 95 (4), pp 601–604 DOI: 10.1021/acs.jchemed.7b00404 résumé de A.-C. N. 2018-2019
2 Occurrences trouvées, Dernière modification:
presentation_principesplugin-autotooltip__default plugin-autotooltip_big* Qu'est-ce qu'un langage de programmation ? * Compilation ou interprétation, ou... ?

* Décrire des instructions dans un langage compréhensible par un être humain, mais transformable en d'autres instructions compréhensibles par l'ordinateur (langage machine)
2 Occurrences trouvées, Dernière modification:
unites_acquis_apprentissagesplugin-autotooltip__default plugin-autotooltip_bigLes unités d’acquis d’apprentissage

L'objectif de cette page est de présenter sous forme de texte électronique cherchable les référentiels “UAA” de chimie dans l'enseignement secondaire (général et technique de transition ou qualification).
2 Occurrences trouvées, Dernière modification:
tp_simulations_monte-carlo_2019plugin-autotooltip__default plugin-autotooltip_bigTP de simulations de Monte-Carlo, 2019

Séances organisées et gérées par Denis Dumont


1D Random Walk :

Montrer que la marche aléatoire conduit à des distributions de déplacements équivalente à ce qu'on observe pour la diffusion de composés chimiques.
2 Occurrences trouvées, Dernière modification:
factorielle-4plugin-autotooltip__default plugin-autotooltip_bigFactorielle : travaux additionnels

Idées d'exercices complémentaires, d'applications.

Utilisation d'un dictionnaire

Il peut être intéressant de précalculer des factorielles qui seront mémorisées dans un dictionnaire.

Comparaison avec l'approximation de Stirling
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed083p1094plugin-autotooltip__default plugin-autotooltip_bigComment motiver les étudiants à étudier avant un laboratoire

How To Motivate Students To Study before They Enter the Lab, Lea Pogacnik et Blaz Cigic, J. Chem Ed. Vol. 83 No. 7 Augustus 2006, pp 1094-1098) Résumé de A.W, 2006-2007

Des études ont montré que les étudiants ne préparent pas suffisamment leur séances de laboratoire pendant leurs études supérieures et consacrent généralement plus de temps aux activités post-laboratoire telles que la rédaction des rapports. Il a été remarqué également…
2 Occurrences trouvées, Dernière modification:
elements_moleculesplugin-autotooltip__default plugin-autotooltip_bigÉléments et molécules

Les propriétés des éléments chimiques, de molécules peuvent être dressées, listées,... par un programme si on dispose des données. Christoph Gohlke (University of California, Irvine), a écrit une librairie molmass pour accéder aux propriétés des éléments, et calculer les masses moléculaires, compositions élémentaires, spectres de distribution des masses de molécules,
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00417plugin-autotooltip__default plugin-autotooltip_bigEnquête sur le raisonnement des étudiants face aux réactions acidobasiques

Investigating Students’ Reasoning about Acid–Base Reactions Melanie M. Cooper, Hovig Kouyoumdjian, and Sonia M. Underwood, J. Chem. Educ., 2016, 93 (10), pp 1703–1712 DOI: 10.1021/acs.jchemed.6b00417 Résumé de S.C., 2016-2017
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00690plugin-autotooltip__default plugin-autotooltip_bigClasse "Escape" : Le processus Leblanc - Un «jeu d'évasion» éducatif

Article : Escape Classroom: The Leblanc Process—An Educational "Escape Game" Nicolas Dietrich, J. Chem. Educ., 2018, 95 (6), pp 996–999 DOI: 10.1021/acs.jchemed.7b00690 résumé de A.M. 2018-2019


Un escape game pédagogique est un jeu d'évasion virtuel ou non, à réaliser en groupe et construit sur une succession d'énigmes permettant d'atteindre un but. Dans notre cas, il s’agit de trouver des combinaisons de nom…
2 Occurrences trouvées, Dernière modification:
progappchimplugin-autotooltip__default plugin-autotooltip_bigProgrammation appliquée à la chimie

Le cours “Programmation appliquée à la chimie” de bachelier en sciences chimiques (15 H cours et 15 H exercices, bloc2) utilise deux supports :

* Principalement, le présent wiki pour ses avantages techniques (coloration et indentation du code, recherche dans les pages, historique des modifications,
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00776plugin-autotooltip__default plugin-autotooltip_bigProduction rapide d'une membrane d'acétate de cellulose poreuse pour la filtration de l'eau à l'aide de produits chimiques facilement disponibles

Article : Rapid Production of a Porous Cellulose Acetate Membrane for Water Filtration using Readily Available Chemicals, Adrian Kaiser, Wendelin J. Stark , and Robert N. Grass, J. Chem. Educ., 2017, 94 (4), pp 483–487 DOI: 10.1021/acs.jchemed.6b00776 résumé de E.C. 2017-2018
2 Occurrences trouvées, Dernière modification:
polynomes-5plugin-autotooltip__default plugin-autotooltip_bigPolynômes : boucle for, fonction mathématique

#!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """ from math import *

def polyeval(x,a): """ Fonction s'occupant uniquement de l'évaluation du polynome fonction de x avec les coefficients dans la liste a """ n = len(a)-1 p = 0. # initialisation for i in range(n+1): p = p + a[i] * x**i #calcul et addition de chacun des termes return p …
2 Occurrences trouvées, Dernière modification:
polynomes-7plugin-autotooltip__default plugin-autotooltip_bigPolynômes : comment les multiplier par un scalaire et les additionner

#!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes + fonction de multiplication d'un polynôme pas un scalaire + fonction d'addition de deux polynômes """ from math import *

def polyeval(x,a): """ application de l'agorithme de Horner cf. """ n = len(a) - 1 # n = ordre du polynôme p =0. for…
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed085p145plugin-autotooltip__default plugin-autotooltip_bigLe rôle des laboratoires dans l’apprentissage de la chimie

The role of the laboratory in the chemistry instruction, M.J.Elliot, K.K.Steward and J.J.Lagowski, J. Chem Ed. Vol. 85 No. 1 January 2008, p 145-149. Résumé de N.S., 2008-2009

De nos jours peu de professeurs (instructeurs) envisagent de donner un cours de chimie de base sans laboratoire. Aussi, les chimistes académiciens et industriels privilégient beaucoup les laboratoires en complément de la théorie, surtout pour les étudiants prépar…
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed100422cplugin-autotooltip__default plugin-autotooltip_bigUtilisation de la théorie de réponses aux items (IRT) pour évaluer les changements de performance des étudiants basés sur les changements dans la formulation des questions

Using Item Response Theory To Assess Changes in Student Performance Based on Changes in Question Wording, Kimberly D. Schurmeier, Charles H. Atwood, Carrie G. Shepler, Gary J. Lautenschlager Journal of Chemical Education, vol 87(11) 2010 pp 1268–1272 (Article) DOI: 10.1021/ed100422c - Résumé de S.S., 2010-2011.
2 Occurrences trouvées, Dernière modification:
cuisine_moleculaireplugin-autotooltip__default plugin-autotooltip_bigLa cuisine moléculaire

L'alimentation serait à l'origine de nos capacités neuronales plus importantes : cf. Suzana Herculano-Houzel’s TED talk

Situations d'apprentissage

* la mayonnaise ratée * l'œuf est très souvent trop cuit : * le jaune devient verdâtre * le jaune est trop sec
2 Occurrences trouvées, Dernière modification:
eigenvalues_and_eigenvectorsplugin-autotooltip__default plugin-autotooltip_bigEigenvalues and eigenvectors

* Eigenvalues and eigenvectors * Important matrix properties * Hermitian, orthogonality,...

* Eigenvalue algorithm * Power iteration, a simple numerical algorithm producing a number $\lambda$, the greatest (in absolute value) eigenvalue of a matrix $A$, and the corresponding eigenvector $v$$Av=\lambda v$
2 Occurrences trouvées, Dernière modification:
polynomes-8plugin-autotooltip__default plugin-autotooltip_bigPolynômes : graphes de fonctions polynomiales

#!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes """ from math import * from pylab import * # librairies de graphiques (matplotlib)

def polyeval(x,a): """ application de l'agorithme de Horner cf. """ n = len(a)-1 # n = ordre du polynome p = 0. for i in range(n,-1,-1): p = p*x + a[i] return p

2 Occurrences trouvées, Dernière modification:
jupyterplugin-autotooltip__default plugin-autotooltip_bigJupyter, IPython Notebooks et JupyterLab

* Jupyter a succédé à IPython Notebook * Jupyter est installé par défaut avec la distribution python Anaconda. C'est la manière la plus adéquate d'utiliser Jupyter. * Sinon, on peut utiliser facilement les notebooks Jupyter sur la plateforme
2 Occurrences trouvées, Dernière modification:
biblio-9780321611956-chap14plugin-autotooltip__default plugin-autotooltip_bigAnimations sur ordinateur de phénomènes chimiques à l'échelle moléculaire

Chemists' Guide to Effective Teaching, Volume II, Norbert J. Pienta, Melanie M. Cooper & Thomas J. Greenbowe, Prentice Hall, 2008, ISBN 9780321611956 - Chapter 14: Computer Animations of Chemical Processes at the Molecular Level (Résumé de S.P., 2013-2014)
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00548plugin-autotooltip__default plugin-autotooltip_bigDémonstration des principes de spectrophotométrie en construisant un spectrophotomètre se basant sur le capteur de luminosité d’un smartphone

Article : Demonstrating Principles of Spectrophotometry by Constructing a Simple, Low-Cost, Functional Spectrophotometer Utilizing the Light Sensor on a Smartphone Bill S. Hosker, J. Chem. Educ., 2018, 95 (1), pp 178–181 DOI: 10.1021/acs.jchemed.7b00548 résumé de J.P. 2018-2019
1 Occurrences trouvées, Dernière modification:
publis_diversesplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes

Dans Journal of Chemical Education




* Total Chemical Footprint of an Experiment: A Systems Thinking Approach to Teaching Rovibrational Spectroscopy Paul D. Cooper, Jacob Walser, J. Chem. Educ. 2019, 96(12), 2947-2951 DOI: 10.1021/acs.jchemed.9b00405 * Valorization of Waste Orange Peel to Produce Shear-Thinning Gels Lucy S. Mackenzie, Helen Tyrrell, Robert Thomas, Avtar S. Matharu, James H. Clark, Glenn A. Hurst, J. Chem. Educ. 2019, 96(12), 3025…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00165plugin-autotooltip__default plugin-autotooltip_bigEnseigner les composés organiques avec un jeu utilisant des notes collantes sur le front

Article Teaching Classes of Organic Compounds with a Sticky Note on Forehead Game Kevin P. O’Halloran, J. Chem. Educ., 2017 DOI:10.1021/acs.jchemed.7b00165 résumé de F.H. 2017-2018


L’auteur de l’article, professeur de chimie, s’est rendu compte que la mémorisation des groupements chimiques en chimie organique se relevait être difficile pour les élèves. Il s’est demandé comment rendre l’appr…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00978plugin-autotooltip__default plugin-autotooltip_bigL'alchimie ancienne dans la salle de classe: une pyrotechnie déflagrante à base de miel

Article : Ancient Alchemy in the Classroom: A Honey-Based, Deflagrating Pyrotechnic A. V. Wolfenden, N. L. kilah, J. Chem. Educ., 2018, 95 (8), pp 1350–1353 DOI:10.1021/acs.jchemed.7b00978 résumé de A.R. 2017-2018

1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00844plugin-autotooltip__default plugin-autotooltip_bigExpérience de la bouteille bleue : Apprendre la chimie sans connaître les produits chimiques

Article Blue Bottle Experiment: Learning Chemistry without Knowing the Chemicals T. Limpanuparb , C. Areekul, P. Montriwat, and U. Rajchakit, J. Chem. Educ., 2017, 94 (6), pp 730–737 DOI: 10.1021/acs.jchemed.6b00844 résumé de F.P. 2017-2018
1 Occurrences trouvées, Dernière modification:
pandasplugin-autotooltip__default plugin-autotooltip_bigPandas

Module pour l'analyse de données, pouvant se substituer à l'utilisation d'un tableur. Une différence fondamentale de la librairie pandas avec NumPy, c'est que les tableaux NumPy (NumPy arrays) ont le même type (dtype) pour le tableau entier, tandis que les tableaux pandas (pandas DataFrames) sont caractérisés par un type unique (dtype) par colonne.$X$$x$$P(x)$$X$$x$$x_1, x_2, x_3, \ldots$$X$$P(x_i)$$X$$x$$P(x)$$x$$x+dx$$P(x)$$x$$P(x) dx$$P(x) dx = P(x \le X < x+dx)$$P(x_i) \ge 0$$x_i$$P(…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed080p779plugin-autotooltip__default plugin-autotooltip_bigEnseigner la chimie organique via la taxonomie de Bloom ?

Teaching Introductory Organic Chemistry: “Blooming beyond a Simple Taxonomy, M.D. Pungente, R.A. Badger, J.Chem.Educ., 2003, 80, 779. Résumé de D.F. 2010-2011. Article d'intérêt didactique


Souvent, la chimie organique est vue pour la plupart des élèves comme la bête noire des sciences. Ils doivent s’accrocher toute l’année pour passer et espèrent mémoriser suffisamment pour réussir ce cours. Les élèves s’inscrivent en chim…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00946plugin-autotooltip__default plugin-autotooltip_bigPoursuite chimique: un jeu de société Trivial modifié

Article: Chemical Pursuit: A Modified Trivia Board Game Blakely M. Adair and Lyle V. McAfee, J. Chem. Educ., 2018, 95 (3), pp 416–418 DOI: 10.1021/acs.jchemed.6b00946 résumé de A.R. 2017-2018 + supporting info (fichiers du jeu)

1 Occurrences trouvées, Dernière modification:
biblio-10.1039-c7rp00135eplugin-autotooltip__default plugin-autotooltip_bigÉtudier la cohérence entre et dans les modèles mentaux de l'étudiant pour la structure atomique

Studying the consistency between and within the student mental models for atomic structure Nikolaos Zarkadis, George Papageorgiou and Dimitrios Stamovlasis, Chem. Educ. Res. Pract., 2017, 18, 893-902, DOI: 10.1039/C7RP00135E Résumé de V.L., 2017-2018 (accès gratuit possible via le site de la RSC)
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.8b00133plugin-autotooltip__default plugin-autotooltip_bigDémonstrations chimiques et attention visuelle : La configuration est elle importante? Mise en évidence issue d'une étude du suivi oculaire, en approche double aveugle

Article Chemistry Demonstrations and Visual Attention: Does the Setup Matter? Evidence from a Double-Blinded Eye-Tracking Study Andreas Nehring and Sebastian Busch, J. Chem. Educ., 2018, 95 (10), pp 1724–1735 DOI: 10.1021/acs.jchemed.8b00133 résumé de M.M.M. 2018-2019
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed400901xplugin-autotooltip__default plugin-autotooltip_bigRemplissage d'un sac en plastique avec du dioxyde de carbone: un laboratoire par démarche d'investigation guidée

Article : Filling a Plastic Bag with Carbon Dioxide: A Student-Designed Guided-Inquiry Lab for Advanced Placement and College Chemistry Courses, Laura M. Lanni, Journal of Chemical Education 2014 91 (9), 1390-1392 DOI: 10.1021/ed400901x résumé de N.D. 2017-2018

1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed5000197plugin-autotooltip__default plugin-autotooltip_bigIntégration des représentations de particules dans la chimie

Integrating Particulate Representations into AP Chemistry and Introductory Chemistry Courses Stephen G. Prilliman, J. Chem. Educ., 2014, 91 (9), pp 1291–1298 DOI: 10.1021/ed5000197 résumé de F.M. 2014-2015, numéro spécial de la revue de septembre 2014, special “AP chemistry curriculum framework”
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed3002336plugin-autotooltip__default plugin-autotooltip_bigApprendre le concept d’équilibre chimique aux élèves de secondaire

A Teaching Sequence for Learning the Concept of Chemical Equilibrium in Secondary School Education Marco Ghirardi, Fabio Marchetti, Claudio Pettinari, Alberto Regis, and Ezio Roletto, J. Chem. Educ., 2014, 91 (1), pp 59–65 DOI: 10.1021/ed3002336 résumé de J.V. 2014-2015
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed400523mplugin-autotooltip__default plugin-autotooltip_bigLa biologie et la chimie du brassage : un cours interdisciplinaire

The Biology and Chemistry of Brewing: An Interdisciplinary Course Paul D. Hooker, William A. Deutschman, and Brian J. Avery, J. Chem. Educ., 2014, 91 (3), pp 336–339 DOI: 10.1021/ed400523m résumé de S.P. 2014-2015

Dans cet article, les auteurs, exposent les principes d’un cours interdisciplinaire sur le thème de la brasserie, cours qu’ils ont mis en place depuis neuf ans et qui a la particularité de créer des liens concrets e…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.8b00129plugin-autotooltip__default plugin-autotooltip_bigAnalyse et identification des principaux acides organiques dans les vins et les jus de fruits par chromatographie sur papier

Article Analysis and Identification of Major Organic Acids in Wine and Fruit Juices by Paper Chromatography Dulani Samarasekara, Courtney Hill, and Deb Mlsna, J. Chem. Educ., 2018, 95 (9), pp 1621–1625 DOI: 10.1021/acs.jchemed.8b00129 résumé de A.M. 2018-2019
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.8b00296plugin-autotooltip__default plugin-autotooltip_bigContenu pédagogique sur la cinétique chimique: sélection de critères pour aborder expérimentalement les conceptions intuitives des étudiants

Article Pedagogical Content Knowledge of Chemical Kinetics: Experiment Selection Criteria To Address Students’ Intuitive Conceptions Ainoa Marzabal, Virginia Delgado, Patricia Moreira, Lorena Barrientos, and Jeannette Moreno, J. Chem. Educ., 2018, 95 (8), pp 1245–1249 DOI: 10.1021/acs.jchemed.8b00296 résumé de F.G. 2018-2019
1 Occurrences trouvées, Dernière modification:
simulations_random_walks_codesplugin-autotooltip__default plugin-autotooltip_bigSimulations numériques de marches aléatoires : programmes en Python

Génération de nombres aléatoires

#!/usr/bin/python # -*- coding: utf-8 -*- """ cf. documentation cf random number generation - génération de nombres aléatoires functions of interest : choice, randint, seed """

from random import *

facepiece = ['pile','face'] valeurpiece = [0.01,0.02,0.05,0.1,0.2,0.5,1.,2.]

for i in range(1): # choice : random choice of an element from a lis…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00942plugin-autotooltip__default plugin-autotooltip_bigUne expérience médico-légale : le cas du crime au cinéma

Article : A Forensic Experiment: The Case of the Crime at the Cinema J. M. Valente Nabais and Sara D. Costa, J. Chem. Educ., 2017, 94 (8), pp 1111–1117 DOI: 10.1021/acs.jchemed.6b00942 résumé de A.D. 2017-2018


Cet article rapporte une activité expérimentale où les étudiants doivent analyser attentivement les preuves recueillies sur le lieu d’un crime, à savoir des fibres et des traces de rouge à lèvres. Les fibres sont a…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00047plugin-autotooltip__default plugin-autotooltip_bigUn spectromètre simple construit par des élèves pour étudier le rayonnement infrarouge et les gaz à effet de serre

Article A Simple, Student-Built Spectrometer To Explore Infrared Radiation and Greenhouse Gases Mitchell R. M. Bruce, Tiffany A. Wilson, Alice E. Bruce, S. Max Bessey, and Virginia J. Flood, J. Chem. Educ., 2016, 93 (11), pp 1908–1915 DOI: 10.1021/acs.jchemed.6b00047 résumé de M.L. 2016-2017
1 Occurrences trouvées, Dernière modification:
numpy_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de NumPy

NumPy est une extension du langage de programmation Python, destinée à manipuler des matrices ou tableaux multidimensionnels ainsi que des fonctions mathématiques opérant sur ces tableaux.

Numpy permet la manipulations des vecteurs, matrices et polynômes.
1 Occurrences trouvées, Dernière modification:
factorielle-2plugin-autotooltip__default plugin-autotooltip_bigFactorielle : un premier programme

Voici un embryon non fonctionnel de programme. Il y manque des éléments (à la place des “???”)

#! /usr/bin/env python # -*- coding: utf-8 -*- """ Calcul de la factorielle d'un nombre Référence : """ # on demande le nombre : print("Calcul de la factorielle de n") chainelue = input("Que vaut n ? ") n = int(chainelue) print(n)

# structure de répétition pour appliquer la définition de la factorielle reponse=1 # la répon…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed100409pplugin-autotooltip__default plugin-autotooltip_bigCombien de temps les étudiants peuvent-ils prêter attention en classe ? Une étude de la baisse d’attention de l’étudiant en utilisant des clickers

How Long Can Students Pay Attention in Class? A Study of Student Attention Decline Using Clickers, D.M. Bunce, E.A. Flens and K.Y. Neiles, Journal of Chemical Education, 2010, 87(12), 1438-1443. Résumé de S.S., 2010-2011.
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.8b00152plugin-autotooltip__default plugin-autotooltip_bigJouer avec le feu: expertise requise en matière de sécurité chimique

Article Playing with Fire: Chemical Safety Expertise Required Samuella B. Sigmann, J. Chem. Educ., 2018, 95 (10), pp 1736–1746 DOI: 10.1021/acs.jchemed.8b00152 résumé de M.R. 2018-2019

Au cours des 20 dernières années, 164 enfants et éducateurs auraient été blessés lors de laboratoire utilisant des solvants inflammables.
1 Occurrences trouvées, Dernière modification:
suite_de_fibonacci-3plugin-autotooltip__default plugin-autotooltip_bigSuite de Fibonacci : écriture de fonctions

Voici la structure que doit avoir un programme pour lequel le calcul de l'élément d'indice n de la suite de Fibonacci est encapsulé dans une fonction :

#! /usr/bin/env python # -*- coding: utf-8 -*- """ Calculs des premiers éléments de la suite de Fibonacci. Référence : """ def fibonacci_item(n): """ Renvoie l'élément d'indice n de la suite de Fibonacci """ ...

if __name__ == '__main__'…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed200823tplugin-autotooltip__default plugin-autotooltip_bigIdentification de pigments végétaux : activité et situation d'apprentissage

Plant Pigment Identification: A Classroom and Outreach Activity Kathleen C. A. Garber et al J. Chem. Educ., 2013, 90 (6), pp 755–759 DOI: 10.1021/ed200823t résumé de S.P. 2014-2015

Objectif de l'article

Séance de laboratoire sur l'identification de composés chimiques particuliers, les anthocyanines, colorants naturels des plantes.
1 Occurrences trouvées, Dernière modification:
biblio-10.1021ed082p313plugin-autotooltip__default plugin-autotooltip_bigExpériences et réflexions à propos de l'enseignement de la structure atomique via une classe puzzle dans l'enseignement secondaire

Experiences and Reflections about Teaching Atomic Structure in a Jigsaw Classroom in Lower Secondary School Chemistry Lessons, Ingo Eilks, J. Chem. Ed. 82(2), pp 313-319,2005. Résumé de A.B. 2010-2011. Article d'intérêt didactique

1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b00190plugin-autotooltip__default plugin-autotooltip_bigVariations sur la démonstration de la "bouteille bleue" avec des aliments contenant un colorant bleu

Variations on the “Blue-Bottle” Demonstration Using Food Items That Contain FD&C Blue #1 Felicia A. Staiger, Joshua P. Peterson, and Dean J. Campbell, J. Chem. Educ., 2015, 92 (10), pp 1684–1686 DOI: 10.1021/acs.jchemed.5b00190 résumé de C.D. 2015-2016
1 Occurrences trouvées, Dernière modification:
physicochimie2-exercicesplugin-autotooltip__default plugin-autotooltip_bigPhysicoChimie II (exercices)

Bachelier en sciences chimiques, troisième année, 30 H exercices du cours (titulaire du cours : P. Damman).

Rappels de probabilités et statistique + quelques applications

Évènements, probabilités : définitions

1 Occurrences trouvées, Dernière modification:
polynomes-6plugin-autotooltip__default plugin-autotooltip_bigPolynômes : la méthode de Horner

432 Cela revient à effectuer les opérations successives suivantes :

* prendre le coefficient de x4 * multiplier par x * ajouter le coefficient de x3 * multiplier par x * ajouter le coefficient de x2 *
1 Occurrences trouvées, Dernière modification:
polynomes-11plugin-autotooltip__default plugin-autotooltip_bigGraphe d'une famille de polynômes orthogonaux

Voici un programme permettant de visualiser les premiers polynômes orthogonaux de Tchebyshev :

#!/usr/bin/env python # -*- coding: utf-8 -*- """ graphes de Polynomes de Chebyschev """

from math import * from pylab import *

def polyeval(x,a): """ application de l'algorithme de Horner cf. """ n = len(a)-1 # n = ordre du polynome p = 0. for i in range(n,-1,-1): …
1 Occurrences trouvées, Dernière modification:
convention_stageplugin-autotooltip__default plugin-autotooltip_bigConvention de stage : modèle et directives

wiki du service de didactique des disciplines scientifiques * lien direct :
1 Occurrences trouvées, Dernière modification:
thermodynamique_statistique-exercicesplugin-autotooltip__default plugin-autotooltip_bigThermodynamique statistique I et II (exercices)

Bachelier en sciences chimiques, troisième année, 15 H (partie I) et 15h (partie II) d'exercices des cours I et II. Titulaire du cours : P. Damman)

Rappels de probabilités et statistique + quelques applications
1 Occurrences trouvées, Dernière modification:
rotateur_biatomiqueplugin-autotooltip__default plugin-autotooltip_bigRotateur biatomique

Cf. cette page.

Code source, en Python 3 :

#!/usr/bin/env python # -*- coding: utf-8 -*- """ Somme d'état (ensemble canonique) de rotation (rotateur biatomique)

Les impressions sont à récrire avec l'instruction format() de python 3 """

from math import exp # on a juste besoin de l'exponentielle import matplotlib.pyplot as plt # directive d'importation standard de Matplotlib

T = 100. # (température réduite = T / Theta) Zrot = 0. # somme d'état Jmax = 30 # valeur …
1 Occurrences trouvées, Dernière modification:
biblio-10.1039-c005464jplugin-autotooltip__default plugin-autotooltip_bigDiagrammes sub-microscopiques générés par les élèves : un outil utile pour enseigner et apprendre les équations chimiques et la stœchiométrie

Student-generated submicro diagrams: a useful tool for teaching and learning chemical equations and stoichiometry, Bette Davidowitz, Gail Chittleborough and Eileen Murray, Chemistry Education Research and Practice, 2010, 11, 154-164. Résumé de M.R., 2010-2011.
1 Occurrences trouvées, Dernière modification:
lennard-jonesplugin-autotooltip__default plugin-autotooltip_bigReprésentation du potentiel de Lennard-Jones

L'utilisation de fonctions en python permet de nombreuses applications par la création de graphiques. En utilisant la “bibliothèque matplotlib/pylab”, vous pourrez donc aisément créer des graphes de fonction.$V_{LJ} = 4\varepsilon \left[ \left(\frac{\sigma}{r}\right)^{12} - \left(\frac{\sigma}{r}\right)^{6} \right] = \varepsilon \left[ \left(\frac{r_{m}}{r}\right)^{12} - 2\left(\frac{r_{m}}{r}\right)^{6} \right]$$r_{m} = 2^{1/6} \sigma$$U_{tot} = \fr…
1 Occurrences trouvées, Dernière modification:
sequences_brins_adnplugin-autotooltip__default plugin-autotooltip_bigSéquences de brins d'ADN

L'ADN (acide désoxyribonucléique) est constitué d'une suite de nucléotides qui existent en quatre types différents (notés A, C, G et T), du nom des bases adénine (A), cytosine (C), guanine (G) et thymine (T). Les brins s'associent en double hélice par une reproduction assurant une correspondance par paires, A et T d'une part, G et C d'autre part.
1 Occurrences trouvées, Dernière modification:
courbe_predominance_acide_2013plugin-autotooltip__default plugin-autotooltip_bigCourbe de Prédominance d'un Acide

#!/usr/bin/env python # -*- coding: utf-8 -*- # travail de KH, ba2 chimie 2012-2013

# Courbe de Prédominance d'un Acide # from math import * import matplotlib.pyplot as plt from Tkinter import *
1 Occurrences trouvées, Dernière modification:
diffusion_chimique_1dplugin-autotooltip__default plugin-autotooltip_bigModélisation de la diffusion chimique dans un film

Technique de différences finies, utilisation de matplotlib

#!/usr/bin/env python # -*- coding: utf-8 -*- from math import * # pour utiliser la librairie graphique matplotlib from pylab import *
1 Occurrences trouvées, Dernière modification:
piegesplugin-autotooltip__default plugin-autotooltip_bigPièges à éviter

Quelques pièges à éviter !

Type de données

* travailler avec des nombres et ne pas mettre le point décimal s'ils ont une valeur entière les laissera dans le type 'int'. * Ne pas confondre une liste contenant un nombre, et ce nombre.
1 Occurrences trouvées, Dernière modification:
maxwell-boltzmannplugin-autotooltip__default plugin-autotooltip_bigReprésentation de la distribution de vitesse de Maxwell-Boltzmann

Pour la théorie, cf. le cours de physico-chimie ou la page Wikipédia sur la distribution de vitesse de Maxwell-Boltzmann

Sans NumPy

#! /usr/bin/env python # -*- coding: utf-8 -*- “”“ NumPy/Matplotib : representation de la distribution de vitesses de Maxwell-Boltzmann version SANS utilisation de NumPy cf cours et
1 Occurrences trouvées, Dernière modification:
ph_courbe_titrage_2011plugin-autotooltip__default plugin-autotooltip_bigpH et courbe de titrage

#!/usr/bin/env python # -*- coding: utf-8 -*- # Programme de calculs de pH et de courbes de titrages # AD & BW, Ba2 chimie 2010-2011

from math import * from Tkinter import * import matplotlib.pyplot as plt import numpy as np
1 Occurrences trouvées, Dernière modification:
paradoxe_anniversairesplugin-autotooltip__default plugin-autotooltip_bigParadoxe des anniversaires


* Quelle est la probabilité qu'au moins deux personnes aient leur anniversaire le même jour dans un groupe de 40 personnes ?


Il est plus simple de passer par le calcul de la probabilité complémentaire Pcomp(N), que toutes les N personnes présentes aient leur anniversaire des jours différents. Si on considère une personne à la fois, on multipliera les probabilités indépendantes d'$1-\frac{N!/(N-k)!}{N^k}$
1 Occurrences trouvées, Dernière modification:
tkinter_gui_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases d'un interface graphique avec Tkinter

Quelques références de base pour utiliser Tkinter

* Documentation officielle : * Les interfaces graphiques TK * tkinter — interface Python à Tcl/Tk, reprenant quelques références recommandées * Python 3 avec Tk intègre également les extensions
1 Occurrences trouvées, Dernière modification:
testplugin-autotooltip__default plugin-autotooltip_bigtest

1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.chemrev.8b00020plugin-autotooltip__default plugin-autotooltip_bigRecherche sur l'enseignement de la chimie - De l'empirisme personnel aux données probantes, à la théorie et à la pratique éclairée

FIXME ; compléter et ajouter à biblio-didactique-chimie

Voir aussi (accès restreint) :

* two-tier multiple choice diagnostic instruments (questions à choix multiple avec justification)
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00256plugin-autotooltip__default plugin-autotooltip_bigLe choc des chimistes: un blog gamifié pour maîtriser le concept de la stœchiométrie des réactifs limitants

Article : Clash of Chemists: A Gamified Blog To Master the Concept of Limiting Reagent Stoichiometry, Nathalie V. le Maire, Dominique Ph. Verpoorten, Marie-Laure S. Fauconnier, and Catherine G. Colaux-Castillo, Journal of Chemical Education Article
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed086p1202plugin-autotooltip__default plugin-autotooltip_bigCombinaison de la chimie et de la musique pour augmenter l'intérêt des étudiants. Utilisation des chansons pour accompagner des matières chimiques

Combining Chemistry and Music To Engage Student Interest", Using Songs To Accompany Selected Chemical Topics, A.M. Last, J. Chem. Ed. Vol. 86 No. 10 October 2009, pp 1202-1204 - Résumé de L.M., 2009-2010
1 Occurrences trouvées, Dernière modification:
conference-brey-20160420plugin-autotooltip__default plugin-autotooltip_bigÀ quoi servent les savoirs scolaires ?

Conférence de Bernard Rey, Charleroi, avril 2016

Annonce :

* Les Cafés Conférences de l’Échevinat de l’enseignement de la Ville de Charleroi, en partenariat avec le Centre de Culture scientifique de l’ULB, l’UAE Charleroi-Le Centre , l’Extension de l’ULB, La Ligue de l’Enseignement et de l’Education permanente et Charleroi Danses proposent une conférence de Bernard Rey, Docteur en Sciences de l’Éducation et Professeur honoraire à l’ULB…
1 Occurrences trouvées, Dernière modification:
  • start.txt
  • Dernière modification: 2020/10/02 14:58
  • de villersd