Outils pour utilisateurs

Outils du site


teaching:progappchim:dictionary_adn_protein

Différences

Ci-dessous, les différences entre deux révisions de la page.

Lien vers cette vue comparative

teaching:progappchim:dictionary_adn_protein [2012/11/30 13:28] (Version actuelle)
villersd créée
Ligne 1: Ligne 1:
 +====== Traduction de l'ADN en séquence d'​acides aminés ======
  
 +<​sxh ​ python; title : dictionary_adn_protein.py>​
 +#​!/​usr/​bin/​env python
 +# -*- coding: iso-8859-1 -*-
 +
 +# python code to translante DNA sequences into proteins
 +# traduction de l'ADN en séquence d'​acides aminés (protéine)
 +
 +def translate_dna(sequence): ​   # to translate a DNA sequence in equivalent protein
 +    # see http://​fr.wikipedia.org/​wiki/​Code_g%C3%A9n%C3%A9tique
 +    # http://​en.wikipedia.org/​wiki/​Genetic_code
 +    gencode = {                   # définition d'un dictionnaire dont chaque clé (un codon de 3 nucléotides) donne l'​acide aminé correpondant
 +    '​ATA':'​I',​ '​ATC':'​I',​ '​ATT':'​I',​ '​ATG':'​M',  ​
 +    '​ACA':'​T',​ '​ACC':'​T',​ '​ACG':'​T',​ '​ACT':'​T',  ​
 +    '​AAC':'​N',​ '​AAT':'​N',​ '​AAA':'​K',​ '​AAG':'​K',  ​
 +    '​AGC':'​S',​ '​AGT':'​S',​ '​AGA':'​R',​ '​AGG':'​R',  ​
 +    '​CTA':'​L',​ '​CTC':'​L',​ '​CTG':'​L',​ '​CTT':'​L',  ​
 +    '​CCA':'​P',​ '​CCC':'​P',​ '​CCG':'​P',​ '​CCT':'​P',  ​
 +    '​CAC':'​H',​ '​CAT':'​H',​ '​CAA':'​Q',​ '​CAG':'​Q',  ​
 +    '​CGA':'​R',​ '​CGC':'​R',​ '​CGG':'​R',​ '​CGT':'​R',  ​
 +    '​GTA':'​V',​ '​GTC':'​V',​ '​GTG':'​V',​ '​GTT':'​V',  ​
 +    '​GCA':'​A',​ '​GCC':'​A',​ '​GCG':'​A',​ '​GCT':'​A',  ​
 +    '​GAC':'​D',​ '​GAT':'​D',​ '​GAA':'​E',​ '​GAG':'​E',  ​
 +    '​GGA':'​G',​ '​GGC':'​G',​ '​GGG':'​G',​ '​GGT':'​G',  ​
 +    '​TCA':'​S',​ '​TCC':'​S',​ '​TCG':'​S',​ '​TCT':'​S',  ​
 +    '​TTC':'​F',​ '​TTT':'​F',​ '​TTA':'​L',​ '​TTG':'​L',  ​
 +    '​TAC':'​Y',​ '​TAT':'​Y',​ '​TAA':'​_',​ '​TAG':'​_',  ​
 +    '​TGC':'​C',​ '​TGT':'​C',​ '​TGA':'​_',​ '​TGG':'​W',​
 +    }
 +    print sequence  ​
 +    proteinseq = ''  ​
 +    for n in range(0,​len(sequence),​3):  ​
 +        if gencode.has_key(sequence[n:​n+3]) == True:  # check that key exists in dictionary
 +            proteinseq += gencode[sequence[n:​n+3]]  ​
 +    return proteinseq
 +
 +
 +#  DNA sequences : GenBank : http://​www.ncbi.nlm.nih.gov/​
 +
 +se='​GTGACTTTGTTCAACGGCCGCGGTATCCTAACCGTGCGAAGGTAGCGTAATCACTTGTTCTTTAAATAAGGACTAGTATGAATGGCATCACGAGGGCTTTACTGTCTCCTTTTTCTAATCAGTGAA'​
 +#​se='​GTGACTTTG'​
 +print len(se)
 +print translate_dna(se)
 +
 +# extensions : lire la séquence à partir d'un fichier
 +# générer des mutations aléatoires de l'ADN et examiner les modifications éventuelles de la protéine
 +# faire correspondre des noms complets ou abbréviations sur 3 lettres des acides aminés
 +# générer l'ARN correspondant
 +</​sxh>​
 +===== références =====
 +  * [[http://​fr.wikipedia.org/​wiki/​Code_g%C3%A9n%C3%A9tique]]
 +  * ...
teaching/progappchim/dictionary_adn_protein.txt · Dernière modification: 2012/11/30 13:28 par villersd