

Voici les résultats de votre recherche.

desinformationsplugin-autotooltip__default plugin-autotooltip_bigDes informations ou désinformations ?

Cette page regroupe quelques exemples d'informations et désinformations, notamment tirés de différents media : presse, réseaux sociaux, blogs, forums,... des désinformations, et parfois aussi une information qui se veut plus conforme aux faits.
4 Occurrences trouvées, Dernière modification:
ducation aux médias et à l'information à l'école (Introduction)]] - Hygiène Mentale, le projet de Rose-Marie Far... Microplastics Are Infiltrating the Environment An introduction to the issue, and exploring the changes we can ma... paru en 2011, Nunn et Qian, estiment ainsi que l'introduction de la pomme de terre est responsable de d'une hau... ation-level impact and herd effects following the introduction of human papillomavirus vaccination programmes: u
notions_avanceesplugin-autotooltip__default plugin-autotooltip_bigNotions avancées

En construction. Les liens sont juste donnés. Une introduction et un exemple devrait être proposé pour chaque rubrique, et le nombre de ces rubriques augmenté.


Générateurs et "yield"

* * * *
1 Occurrences trouvées, Dernière modification:
En construction. Les liens sont juste donnés. Une introduction et un exemple devrait être proposé pour chaque ru
stackexchange-chimieplugin-autotooltip__default plugin-autotooltip_bigQuestions et réponses en chimie sur chemistry.stackexchange

Chemistry Stack Exchange est un site de questions et réponses pour les scientifiques, les enseignants, les étudiants,... Il est gratuit, est son contenu est sous licence libre (copyleft) Creative Commons BY-SA. Aucune inscription n'est requise pour la consultation. Vous devez vous identifier pour y contribuer. Le fonctionnement est réglé par un système de
2 Occurrences trouvées, Dernière modification:
://|An introduction to “oxidation state”/“oxidation number”]] * [[http://chem
ppooplugin-autotooltip__default plugin-autotooltip_bigProgrammation Python Orientée Objet

FIXME : en construction

Concepts utilisés

* Un objet : c'est... n'importe quoi, qui peut être codé. En Python, tout est objet ! * Une classe est une description générique d'un type d'objet, incluant les données et les méthodes qui le caractérisent
1 Occurrences trouvées, Dernière modification:
/usr/bin/env python3 # -*- coding: utf-8 -*- """ Introduction to object-oriented programming in Python Led wit
articles_didactique_chimieplugin-autotooltip__default plugin-autotooltip_bigSélection d'articles en didactique de la chimie

Liens rapides :

* : numéro courant de Journal of Chemical Education où vous avez la possibilité de consulter les résumés. Si vous souhaitez recevoir la table des matières à chaque nouveau numéro, il vous suffit de prendre l'option
7 Occurrences trouvées, Dernière modification:
ps://|Introduction to the Journal of Chemical Education Special Issu... ps://|Introduction to Medicinal Chemistry: A Five-Day Course for Hig... ps://|Introduction to Laboratory Safety for Graduate Students: An Ac... tp://|Introduction to Stochastic Simulations for Chemical and Physic
progappchimplugin-autotooltip__default plugin-autotooltip_bigProgrammation appliquée à la chimie

Le cours “Programmation appliquée à la chimie” de bachelier en sciences chimiques (15 H cours et 15 H exercices, bloc2) utilise deux supports :

* Principalement, le présent wiki pour ses avantages techniques (coloration et indentation du code, recherche dans les pages, historique des modifications,
1 Occurrences trouvées, Dernière modification:
=== {{wp:fr>Jupyter}} * [[jupyter|Jupyter]] : introduction, exemples, liens,... * [[bokeh_simple|Les bases
psychologie_de_l_educationplugin-autotooltip__default plugin-autotooltip_bigPsychologie de l'éducation

Thématiques reliées : neurosciences, cognition/métacognition, motivation,...

À ajouter :

* Sweller, cognitive Load,... * Paul A. Kirschner, Carl Hendrick : How Learning Happens - Seminal Works in Educational Psychology and What They Mean in Practice Routledge (2020) * meta-cognition... (ou une thématique spécifique de neuro-éducation
1 Occurrences trouvées, Dernière modification:
ncevoir des environnements éducatifs permettant l’introduction réussie de nouvelles technologies. Cet article dé
matplotlib_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Matplotlib, une librairie pour réaliser des graphiques 2D

Matplotlib est une bibliothèque très puissante du langage de programmation Python destinée à tracer et visualiser des données sous formes de graphiques. Elle est souvent combinée avec les bibliothèques python de calcul scientifique :
3 Occurrences trouvées, Dernière modification:
els du Max Planck Institute for Astronomy]], avec introduction et fonctions avancées * [[ in matplotlib]] * [[|Introduction to Matplotlib — Data Visualization in Python]]
pythonplugin-autotooltip__default plugin-autotooltip_bigPython : quelques références, trucs et astuces

Python est un langage de programmation de haut niveau, libre, polyvalent, facilement accessible aux débutants, mais permettant aussi de réaliser des applications sophistiquées et professionnelles. Certains l'utilisent simplement comme langage de script, pour automatiser et faciliter différentes tâches informatiques.
21 Occurrences trouvées, Dernière modification:
destinée à en faciliter l'apprentissage. Pour une introduction plus complète, //cf.// la [[http://fr.wikipedia.o... ps://|An Introduction to Interactive Programming in Python (Beginners)]... igne Coursera) * [[|Introduction to Computer Science and Programming Using Python]], cours en ligne
numpy_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de NumPy

NumPy est une extension du langage de programmation Python, destinée à manipuler des matrices ou tableaux multidimensionnels ainsi que des fonctions mathématiques opérant sur ces tableaux.

Numpy permet la manipulations des vecteurs, matrices et polynômes.
2 Occurrences trouvées, Dernière modification:|Introduction à Numpy, Scipy et Matplotlib]] * [[http://scipy... rt1-array-python-examples/|Numpy Tutorial Part 1: Introduction to Arrays]] * [[https://www.machinelearningplus
pandasplugin-autotooltip__default plugin-autotooltip_bigPandas

Module pour l'analyse de données, pouvant se substituer à l'utilisation d'un tableur. Une différence fondamentale de la librairie pandas avec NumPy, c'est que les tableaux NumPy (NumPy arrays) ont le même type (dtype) pour le tableau entier, tandis que les tableaux pandas (pandas DataFrames) sont caractérisés par un type unique (dtype) par colonne.$X$$x$$P(x)$$X$$x$$x_1, x_2, x_3, \ldots$$X$$P(x_i)$$X$$x$$P(x)$$x$$x+dx$$P(x)$$x$$P(x) dx$$P(x) dx = P(x \le X < x+dx)$$P(x_i) \ge 0$$x_i$$P(…
1 Occurrences trouvées, Dernière modification:
ex.htm]] * [[]] (limit
biblio-10.1021-ed086p1202plugin-autotooltip__default plugin-autotooltip_bigCombiner la chimie et la musique pour susciter l'intérêt des élèves. Utilisation de chansons pour accompagner certains sujets de chimie

Combining Chemistry and Music To Engage Student Interest", Using Songs To Accompany Selected Chemical Topics, A.M. Last, J. Chem. Ed. Vol. 86 No. 10 October 2009, pp 1202-1204 DOI: 10.1021/ed086p1202 - Résumé de L.M., 2009-2010
1 Occurrences trouvées, Dernière modification:
dans différents cours, principalement en guide d’introduction d’une nouvelle matière ou en fin de chapitre, lor
biblio-didactique-chimieplugin-autotooltip__default plugin-autotooltip_bigPublications intéressantes en didactique de la chimie, mais pas seulement

La plupart des résumés de publications sont issus d'analyses d'articles effectuées par des étudiants dans le cadre des études d'AESS en chimie ou de bacheliers/masters en chimie (les initiales et années sont alors indiquées), pour des publications souvent issues de cette
5 Occurrences trouvées, Dernière modification:
toire utilisant des modèles moléculaires pour une introduction en chimie]] - [[biblio-10.1039-B4RP90005G|Atome... s aider ?]] - [[biblio-9780131493926-chap10|Une introduction à l'apprentissage en petits groupes]] (FIXME : à ... - [[teaching:biblio-10.1021-acs.jchemed.5b01037|Introduction de méthodologies basées sur des enquêtes lors de ... personnes: Un cadre pour engager les étudiants d'introduction à la chimie]] - [[biblio-10.1021-acs.jchemed.8b
potentiel_energy_surfaceplugin-autotooltip__default plugin-autotooltip_bigSurface d'énergie potentielle


Eyring et Polanyi ont publié en 1931 l'article On Simple Gas Reactions dans lequel ils décrivent les trajets des atomes dans la réaction + H --> H + (échange d'atomes). Ces travaux aboutiront au développement des notions de $E_{bond}= D_e [\exp(-2\beta(r-r_e))-2\exp(-\beta(r-r_e))]$$E_{ant}= \frac{D_e}{2} [\exp(-2\beta(r-r_e))+2\exp(-\beta(r-r_e))]$$r_e$$D_e$$\beta$$E_{bond}= \frac{Q_{AB}+\alpha_{AB}}{1+S^2_{AB}} = \frac{Q_{AB}+\alpha_{AB}}{1+k}$$E_{a…
1 Occurrences trouvées, Dernière modification:|Introduction to potential energy surfaces and graphical interp
initinfoplugin-autotooltip__default plugin-autotooltip_bigInitiation à l'informatique

Cours libre en ligne à destination des étudiants de la section chimie. Si vous avez des questions ou souhaits de compléments d'informations, ou d'ajouts de rubriques, vous pouvez utiliser ce formulaire de contact.

Les bases de l'informatique
4 Occurrences trouvées, Dernière modification:
bird/]], [[]] et [[]... : [[]] ==== Graphisme vectoriel e... te qualité typographique. === HTML === Pour une introduction, vous pouvez consulter les pages Introduction à HTML (et pages associées) du [[
h5pplugin-autotooltip__default plugin-autotooltip_bigH5P

FIXME (à intégrer) :

* floss:h5p [Didier Villers, UMONS - wiki] * Contents | H5P * Contents | H5P * Contents | H5P * Contents | H5P * Contents | H5P * Contents | H5P * Catalogue of H5P Content | eCampusOntario H5P Studio * Catalogue of H5P Content * Methods and protocols * Unit 1 - Changes and Properties * Digestive System Labelling Activity * Lung Volume Terminology * Nephron Labeling Activity * Male Reproductive System - Hotspot * Male Reproductive…
3 Occurrences trouvées, Dernière modification:
plotly_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Plotly

Plotly ( est une société développant des outils analytiques et de visualisation. La librairie python Plotly permet de créer des graphes dans l'environnement de Jupyter. FIXME : à compléter


*, le site officiel
2 Occurrences trouvées, Dernière modification:
rappels-proba-statplugin-autotooltip__default plugin-autotooltip_bigRappels de probabilités et statistique + quelques applications

Évènements, probabilités : définitions

* Épreuve ou expérience aléatoire : processus dont le résultat est incertain (tirage au hasard , jets de pièces, de dès,...) * Évènement$\Omega$$E_i$$p(E_i)$$0
1 Occurrences trouvées, Dernière modification:
algos_graphesplugin-autotooltip__default plugin-autotooltip_bigAlgorithmes de graphes

Références diverses

* * * * * * (depuis Python 3.9)
1 Occurrences trouvées, Dernière modification:
methcalchimplugin-autotooltip__default plugin-autotooltip_bigCalculation methods applied to chemistry

Synopsis (english)

Mathematical prerequisites

Programming bases and tools

* Python programming language * interactive tutorial with code execution * DataCamp free course "Intro to Python for Data Science" * Python 3 Tutorial, interactive, with code use in web browser * MOOCs (massive open online courses) :
5 Occurrences trouvées, Dernière modification:
config_ubuntu_serverplugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un serveur sous Ubuntu

* Configuration pour usage général et scientifique * Téléchargement : , dernière version : Ubuntu Server 20.04 LTS Focal Fossa, architecture AMD64 (03/07/2020) * Gravure du fichier iso, ou préparation d'une clé USB via Balena-Etcher (par exemple)
1 Occurrences trouvées, Dernière modification:
thermodynamique_statistique-exercicesplugin-autotooltip__default plugin-autotooltip_bigThermodynamique statistique I et II (exercices)

Bachelier en sciences chimiques, troisième année, 15 H (partie I) et 15h (partie II) d'exercices des cours I et II. Titulaire du cours : P. Damman)

Rappels de probabilités et statistique + quelques applications
1 Occurrences trouvées, Dernière modification:
latexplugin-autotooltip__default plugin-autotooltip_bigLaTeX : quelques références et astuces pour son utilisation

TeX est un langage de composition typographique adapté à la production de documents techniques, scientifiques et mathématiques de grande qualité typographique. Il permet également de produire toutes sortes d'autres documents, qu'il s'agisse de simples lettres ou de livres entiers. LaTeX est un regroupement de macros qui utilisent TeX comme outil de mise en page. TeX et LaTeX sont des logiciels libres et gratuits. LaTeX a été initiale…
5 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.chemrev.8b00020plugin-autotooltip__default plugin-autotooltip_bigRecherche sur l'enseignement de la chimie - De l'empirisme personnel aux données probantes, à la théorie et à la pratique éclairée

FIXME ; compléter et ajouter à biblio-didactique-chimie

Voir aussi (accès restreint) :

* two-tier multiple choice diagnostic instruments (questions à choix multiple avec justification)
1 Occurrences trouvées, Dernière modification:
config_ubuntu_server-18.04plugin-autotooltip__default plugin-autotooltip_bigConfiguration type d'un serveur sous Ubuntu 18.04 Bionic Beaver

* 06/01/2020 Ubuntu server 19.10 Eoan Ermine : : 64-bit PC (AMD64) server install image (utile pour l'intérêt des nouveautés, avec possibilité de mise à jour proche vers la 20.04 LTS) * 09/07/2020 Ubuntu server 18.04.4 Bionic Beaver (
1 Occurrences trouvées, Dernière modification:
bokeh_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases de Bokeh, une librairie pour des visualisations interactives dans un navigateur web

* page d'entrée sur Bokeh * User guide * Galerie d'exemples * Bokeh dans les Jupyter notebooks * Bokeh tutorial in live Jupyter Notebooks * Reference guide

* Réseaux sociaux : * Twitter * GitHub * Youtube

Exemples scientifiques

* Interactions sur la fonction sinus (amplitude, décalage vertical, fréquence, déphasage) +
1 Occurrences trouvées, Dernière modification:
bioinformaticplugin-autotooltip__default plugin-autotooltip_bigBioinformatique

Manipulations de séquences ADN, ARN, protéines,...

Compter les nucléotides d'une séquence ADN

#!/usr/bin/env python # -*- coding: utf-8 -*- """ On dispose d'un exemple de chaîne ADN (constituée des symboles 'A', 'C', 'G', 'T') Le programme utilise plusieurs techniques pour donner les nombres d'occurrences respectifs des différentes bases """ adn = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

# utilisation d'une liste et de la méthode .count() base…
2 Occurrences trouvées, Dernière modification:
dokuwikiplugin-autotooltip__default plugin-autotooltip_bigDokuWiki

* Présentations : * DokuWiki, un wiki "One size fits all" : conférence JDL du 20 février 2020 * Présentation JDL du 20 février 2020 (slideshow) * rss (test-rss) * tables (test-table) * Extensions

* Dokuwiki, un wiki polyvalent et efficace aux nombreuses fonctionnalités

* fr:DokuWiki : sur wikipédia * DokuWiki : sur wikipedia en anglais * : site web officiel * : gitHub reposit…
1 Occurrences trouvées, Dernière modification:
unites_acquis_apprentissagesplugin-autotooltip__default plugin-autotooltip_bigLes unités d’acquis d’apprentissage

L'objectif de cette page est de présenter sous forme de texte électronique cherchable les référentiels “UAA” de chimie dans l'enseignement secondaire (général et technique de transition ou qualification).
2 Occurrences trouvées, Dernière modification:
tkinter_gui_simpleplugin-autotooltip__default plugin-autotooltip_bigLes bases d'un interface graphique avec Tkinter

Quelques références de base pour utiliser Tkinter

* Documentation officielle : * Les interfaces graphiques TK * tkinter — interface Python à Tcl/Tk, reprenant quelques références recommandées * Python 3 avec Tk intègre également les extensions
3 Occurrences trouvées, Dernière modification:
mapathonplugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 25 mars 2020

FIXME : page pour l'édition 2020 en construction !!

Liens rapides :

* Présentation introductive générale du Mapathon 2020 * Les instructions pour faire de la carto humanitaire libre "HOT OSM" (source) * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule
2 Occurrences trouvées, Dernière modification:
mapathon2019plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 27 mars 2019

Liens rapides :

* Présentation introductive générale du Mapathon 2019 * Les instructions pour faire de la carto humanitaire libre "HOT OSM" (source) * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site *
1 Occurrences trouvées, Dernière modification:
dokuwiki-presentation-jdl-20200220plugin-autotooltip__default plugin-autotooltip_bigDidier Villers (UMONS & ASBL LoLiGrUB)

20 février 2020, conférence “Jeudis du Libre”

* pas de connaissance php * pas consultant DokuWiki * utilisateur depuis près de 10 ans

* Système de gestion de contenu (Content Management System, CMS) * Wiki : création, modification et présentation (web)
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.8b00133plugin-autotooltip__default plugin-autotooltip_bigDémonstrations chimiques et attention visuelle : La configuration est elle importante? Mise en évidence issue d'une étude du suivi oculaire, en approche double aveugle

Article Chemistry Demonstrations and Visual Attention: Does the Setup Matter? Evidence from a Double-Blinded Eye-Tracking Study Andreas Nehring and Sebastian Busch, J. Chem. Educ., 2018, 95 (10), pp 1724–1735 DOI: 10.1021/acs.jchemed.8b00133 résumé de M.M.M. 2018-2019
1 Occurrences trouvées, Dernière modification:
biblio-10.1016-j.chb.2015.08.038plugin-autotooltip__default plugin-autotooltip_bigL'efficacité des exemples résolus par rapport aux exemples erronés, à la résolution de problèmes avec tutorat et à la résolution de problèmes dans des environnements d'apprentissage basés sur ordinateur

The efficiency of worked examples compared to erroneous examples, tutored problem solving, and problem solving in computer-based learning environments Bruce M. McLaren, Tamara van Gog, Craig Ganoe, Michael Karabinos, David Yaron, Computers in Human Behavior Volume 55, Part A, February 2016, Page…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00226plugin-autotooltip__default plugin-autotooltip_bigLe tableau périodique des personnes: Un cadre pour engager les étudiants d'introduction à la chimie

Article The People Periodic Table: A Framework for Engaging Introductory Chemistry Students Adam Hoffman and Mark Hennessy, J. Chem. Educ., 2018, 95 (2), pp 281–285 DOI: 10.1021/acs.jchemed.7b00226 résumé de A.-C. N. 2018-2019
4 Occurrences trouvées, Dernière modification:
timeline-chimieplugin-autotooltip__default plugin-autotooltip_bigLigne du Temps de la Chimie


Toute science progresse par la réalisation et l'interprétation d'expériences, par l'introduction de nouveaux concepts, ... Des améliorations et corrections se succèdent alors, dévoilant parfois des erreurs ou des imprécisions du passé. Dans de nombreuses situations, la recherche scientifique induit des interrogations sur l'articulation des travaux actuels par rapport à la masse des connaissances précédentes. Dès lors, on se rend compte qu'une connaissanc…
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed500891wplugin-autotooltip__default plugin-autotooltip_bigComprendre la relation entre les concepts d’Arrhénius, de Bronsted-Lowry et de Lewis

Article Understanding the Relationship Among Arrhenius, Brønsted–Lowry, and Lewis Theories Seoung-Hey Paik, J. Chem. Educ., 2015, 92 (9), pp 1484–1489 DOI: 10.1021/ed500891w résumé de S.G. 2015-2016


Il existe de nombreux problèmes dans l’apprentissage par les élèves des concepts d’acide et de base. Ceux – ci sont notamment causés par la description utilisée par les manuels scolaires. En effet, …
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b01010plugin-autotooltip__default plugin-autotooltip_bigEfficacité des leçons basées sur la recherche utilisant les modèles au niveau particulaire pour développer la compréhension conceptuelle de la Stœchiométrie par les élèves du secondaire

Article Effectiveness of Inquiry-Based Lessons Using Particulate Level Models To Develop High School Students’ Understanding of Conceptual Stoichiometry, Stephanie Kimberlin and Ellen Yezierski, J. Chem. Educ., 2016, 93 (6), pp 1002–1009 DOI: 10.1021/acs.jchemed.5b01010 résumé de A.H. 2016-2017
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed101160xplugin-autotooltip__default plugin-autotooltip_bigCréation d'un environnement d'apprentissage positif par l'utilisation de clickers en classes de chimie dans le secondaire

Creating a Positive Learning Environment with the Use of Clickers in a High School Chemistry Classroom, Fred Vital, J. Chem. Educ. 2012, 89, 470-473. Résumé de B.V.A., 2011-2012.


Les clickers sont de petits dispositifs manuels, utilisés typiquement à l’Université pour répondre directement aux questions posées en classe. Bien que leur efficacité soit non conc…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed5000197plugin-autotooltip__default plugin-autotooltip_bigIntégration des représentations de particules dans la chimie

Integrating Particulate Representations into AP Chemistry and Introductory Chemistry Courses Stephen G. Prilliman, J. Chem. Educ., 2014, 91 (9), pp 1291–1298 DOI: 10.1021/ed5000197 résumé de F.M. 2014-2015, numéro spécial de la revue de septembre 2014, special “AP chemistry curriculum framework”
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b00203plugin-autotooltip__default plugin-autotooltip_bigPourquoi demander pourquoi ?

Article : Why Ask Why? Melanie M. Cooper, J. Chem. Educ., 2015, 92 (8), pp 1273–1279 DOI: 10.1021/acs.jchemed.5b00203 résumé de C.M. 2015-20162015-2016


Dans cet article, l’auteur dit qu’il est important d’aider les étudiants à construire des explications mécanistiques et causales des phénomènes, c’est-à-dire, aider les étudiants à utiliser leur compréhension des interactions au niveau moléculaire afin d’expliquer et prédire les événements se produisant au …
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00034plugin-autotooltip__default plugin-autotooltip_bigUn aperçu de la façon dont les élèves apprennent la différence entre un acide faible et un acide fort à partir de tutoriels animés utilisant des visualisations

Article Insights into How Students Learn the Difference between a Weak Acid and a Strong Acid from Cartoon Tutorials Employing Visualizations, Resa M. Kelly and Sevil Akaygun, J. Chem. Educ., 2016, 93 (6), pp 1010–1019 DOI: 10.1021/acs.jchemed.6b00034 résumé de B.D. 2016-2017
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b01037plugin-autotooltip__default plugin-autotooltip_bigIntroduction de méthodologies basées sur des enquêtes lors de la formation initiale d'enseignants du secondaire en utilisant un problème ouvert sur les transformations chimiques

Article Introducing Inquiry-Based Methodologies during Initial Secondary Education Teacher Training Using an Open-Ended Problem about Chemical Change, Iñigo Rodríguez-Arteche and M. Mercedes Martínez-Aznar, J. Chem. Educ., 2016, 93 (9), pp 1528–1535 DOI: 10.1021/acs.jchemed.5b01037 résumé de E.M. 2016-2017
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00558plugin-autotooltip__default plugin-autotooltip_bigApproche basée sur les problèmes pour l'enseignement des laboratoires avancés de chimie et le développement de compétences de réflexion critique des étudiants

Article : Problem-Based Approach to Teaching Advanced Chemistry Laboratories and Developing Students’ Critical Thinking Skills, Joseph G. Quattrucci, J. Chem. Educ., 2018, 95 (2), pp 259–266 DOI: 10.1021/acs.jchemed.7b00558 résumé de J.D. 2017-2018
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b00109plugin-autotooltip__default plugin-autotooltip_big5 choses que les chimistes devraient savoir à propos de la littérature de la recherche en éducation

Article Five Things Chemists (and Other Science Faculty) Should Know about the Education Research Literature S. Seethaler, J. Chem. Educ., 2016, 93 (1), pp 9–12 DOI: 10.1021/acs.jchemed.5b00109 résumé de M.A. 2016-2017


De nombreuses études empiriques démontrent la valeur ajoutée de l’apprentissage actif, c’est-à-dire une approche constructive du savoir. Si l’enseignant suit cette…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed500658splugin-autotooltip__default plugin-autotooltip_bigImplémentation d’une séquence didactique sur la loi de l’équilibre chimique à l'intention d'élèves du secondaire

Article Implementing an Equilibrium Law Teaching Sequence for Secondary School Students To Learn Chemical Equilibrium Marco Ghirardi, Fabio Marchetti, Claudio Pettinari, Alberto Regis, and Ezio Roletto, J. Chem. Educ., 2015, 92 (6), pp 1008–1015 DOI: 10.1021/ed500658s Résumé de C.M. 2015-2016$\frac{[C]^x[D]^y}{[A]^m[B]^n} = \frac{k_{directe}}{k_{inverse}} = K_{eq}$
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed4005722plugin-autotooltip__default plugin-autotooltip_bigDétermination sur le terrain ou en laboratoire des ions calcium de l'eau de mer

Field and In-Lab Determination of Ca2+ in Seawater Robin Stoodley, Jose R. Rodriguez Nuñez, and Tessa Bartz, J. Chem. Educ., 2014, 91 (11), pp 1954–1957 DOI: 10.1021/ed4005722 résumé de S.L. 2014-2015

Cet article nous présente un travail effectué sur le terrain par des étudiants et son intérêt.
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed200823tplugin-autotooltip__default plugin-autotooltip_bigIdentification de pigments végétaux : activité et situation d'apprentissage

Plant Pigment Identification: A Classroom and Outreach Activity Kathleen C. A. Garber et al J. Chem. Educ., 2013, 90 (6), pp 755–759 DOI: 10.1021/ed200823t résumé de S.P. 2014-2015

Objectif de l'article

Séance de laboratoire sur l'identification de composés chimiques particuliers, les anthocyanines, colorants naturels des plantes.
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed500615aplugin-autotooltip__default plugin-autotooltip_bigCréer et synthétiser des senteurs artificielles en utilisant la chimie des parfums 

Article Using Flavor Chemistry To Design and Synthesize Artificial Scents and Flavors Jessica L. Epstein, Michael Castaldi, Grishma Patel, Peter Telidecki, and Kevin Karakkatt, J. Chem. Educ., 2015, 92 (5), pp 954–957 DOI: 10.1021/ed500615a résumé de G.D. 2015-2016
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed400851mplugin-autotooltip__default plugin-autotooltip_bigIntégration de senseurs en papier à base de nanoparticules : un exemple d’application pour une analyse colorimétrique rapide d’antioxydants

Article Integration of Nanoparticle-Based Paper Sensors into the Classroom: An Example of Application for Rapid Colorimetric Analysis of Antioxidants Erica Sharpe and Silvana Andreescu, J. Chem. Educ., 2015, 92 (5), pp 886–891 DOI: 10.1021/ed400851m résumé de G.D. 2015-2016
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed4003578plugin-autotooltip__default plugin-autotooltip_bigLes perceptions des élèves concernant l'utilisation de jeux éducatifs comme outil pour enseigner le tableau périodique des éléments au niveau secondaire

Articles Students’ Perceptions about the Use of Educational Games as a Tool for Teaching the Periodic Table of Elements at the High School Level Antonio Joaquín Franco-Mariscal, José María Oliva-Martínez, and M. L. Almoraima Gil, J. Chem. Educ., 2015, 92 (2), pp 278–285 DOI: 10.1021/ed4003578 résumé de G.V. 2015-2016
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed5001729plugin-autotooltip__default plugin-autotooltip_bigL'oxydation du Fer : Expérimentation, simulation et analyse dans l'introduction de la chimie

Article The Oxidation of Iron: Experiment, Simulation, and Analysis in Introductory Chemistry Frederic E. Schubert, J. Chem. Educ., 2015, 92 (3), pp 517–520 DOI: 10.1021/ed5001729 résumé de S.G. 2015-2016


Le but de cet article est de démontrer l'importance de l'oxydation de fer et confronter des données obtenues par expérimentation et par simulation.
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.8b00378plugin-autotooltip__default plugin-autotooltip_bigTampon en contexte : lingettes pour bébé comme solution tampon

Article : Buffers in Context: Baby Wipes As a Buffer System Jon-Marc G. Rodriguez, Sarah Hensiek, Jeanne R. Meyer, Cynthia J. Harwood, and Marcy H. Towns, J. Chem. Educ., 2018, 95 (10), pp 1816–1820 DOI: 10.1021/acs.jchemed.8b00378 résumé de M.M.M. 2018-2019
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00739plugin-autotooltip__default plugin-autotooltip_bigLa chimie des bonbons: une approche douce pour enseigner aux sections non scientifiques

Article : Chemistry of Candy: A Sweet Approach to Teaching Nonscience Majors Jennifer Logan Bayline, Halie M. Tucci, David W. Miller, Kaitlin D. Roderick, and Patricia A. Brletic, J. Chem. Educ., 2018, 95 (8), pp 1307–1315 DOI: 10.1021/acs.jchemed.7b00739 résumé de A.W. 2018-2019
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00690plugin-autotooltip__default plugin-autotooltip_bigClasse "Escape" : Le processus Leblanc - Un «jeu d'évasion» éducatif

Article : Escape Classroom: The Leblanc Process—An Educational "Escape Game" Nicolas Dietrich, J. Chem. Educ., 2018, 95 (6), pp 996–999 DOI: 10.1021/acs.jchemed.7b00690 résumé de A.M. 2018-2019


Un escape game pédagogique est un jeu d'évasion virtuel ou non, à réaliser en groupe et construit sur une succession d'énigmes permettant d'atteindre un but. Dans notre cas, il s’agit de trouver des combinaisons de nom…
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00680plugin-autotooltip__default plugin-autotooltip_bigDémonstration de la séquestration du CO2 à l'aide d'olivine et de boissons gazeuses avec des étudiants du secondaire pour étudier les concepts de pH et de conductivité électrique

Demonstrating CO2 Sequestration Using Olivine and Carbonated Beverages with Secondary School Students To Investigate pH and Electrical Conductivity Concepts Johan A. Linthorst and Johanna van der Wal-Veuger, J. Chem. Educ., 2018, 95 (9), pp 1612–1614 DOI: 10.1021/acs.jchemed.7b00680 résumé de F.G. 2018-2019
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00978plugin-autotooltip__default plugin-autotooltip_bigL'alchimie ancienne dans la salle de classe: une pyrotechnie déflagrante à base de miel

Article : Ancient Alchemy in the Classroom: A Honey-Based, Deflagrating Pyrotechnic A. V. Wolfenden, N. L. kilah, J. Chem. Educ., 2018, 95 (8), pp 1350–1353 DOI:10.1021/acs.jchemed.7b00978 résumé de A.R. 2017-2018

1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00946plugin-autotooltip__default plugin-autotooltip_bigPoursuite chimique: un jeu de société Trivial modifié

Article: Chemical Pursuit: A Modified Trivia Board Game Blakely M. Adair and Lyle V. McAfee, J. Chem. Educ., 2018, 95 (3), pp 416–418 DOI: 10.1021/acs.jchemed.6b00946 résumé de A.R. 2017-2018 + supporting info (fichiers du jeu)

1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00165plugin-autotooltip__default plugin-autotooltip_bigEnseigner les composés organiques avec un jeu utilisant des notes collantes sur le front

Article Teaching Classes of Organic Compounds with a Sticky Note on Forehead Game Kevin P. O’Halloran, J. Chem. Educ., 2017 DOI:10.1021/acs.jchemed.7b00165 résumé de F.H. 2017-2018


L’auteur de l’article, professeur de chimie, s’est rendu compte que la mémorisation des groupements chimiques en chimie organique se relevait être difficile pour les élèves. Il s’est demandé comment rendre l’appr…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00891plugin-autotooltip__default plugin-autotooltip_bigDétermination de l'acidité titrable dans le vin à l'aide de méthodes potentiométriques, conductimétriques et photométriques

Article : Determination of Titratable Acidity in Wine Using Potentiometric, Conductometric, and Photometric Methods Dietrich A. Volmer, Luana Curbani, Timothy A. Parker, Jennifer Garcia, Linda D. Schultz, and Endler Marcel Borges, J. Chem. Educ., 2017, 94 (9), pp 1296–1302 DOI: 10.1021/acs.jchemed.6b00891 résumé de J.D. 2017-2018
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00942plugin-autotooltip__default plugin-autotooltip_bigUne expérience médico-légale : le cas du crime au cinéma

Article : A Forensic Experiment: The Case of the Crime at the Cinema J. M. Valente Nabais and Sara D. Costa, J. Chem. Educ., 2017, 94 (8), pp 1111–1117 DOI: 10.1021/acs.jchemed.6b00942 résumé de A.D. 2017-2018


Cet article rapporte une activité expérimentale où les étudiants doivent analyser attentivement les preuves recueillies sur le lieu d’un crime, à savoir des fibres et des traces de rouge à lèvres. Les fibres sont a…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed400901xplugin-autotooltip__default plugin-autotooltip_bigRemplissage d'un sac en plastique avec du dioxyde de carbone: un laboratoire par démarche d'investigation guidée

Article : Filling a Plastic Bag with Carbon Dioxide: A Student-Designed Guided-Inquiry Lab for Advanced Placement and College Chemistry Courses, Laura M. Lanni, Journal of Chemical Education 2014 91 (9), 1390-1392 DOI: 10.1021/ed400901x résumé de N.D. 2017-2018

1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00776plugin-autotooltip__default plugin-autotooltip_bigProduction rapide d'une membrane d'acétate de cellulose poreuse pour la filtration de l'eau à l'aide de produits chimiques facilement disponibles

Article : Rapid Production of a Porous Cellulose Acetate Membrane for Water Filtration using Readily Available Chemicals, Adrian Kaiser, Wendelin J. Stark , and Robert N. Grass, J. Chem. Educ., 2017, 94 (4), pp 483–487 DOI: 10.1021/acs.jchemed.6b00776 résumé de E.C. 2017-2018
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00252plugin-autotooltip__default plugin-autotooltip_bigUne démonstration colorée pour visualiser et investiguer les concepts essentiels de l'équilibre chimique

Article A Colorful Demonstration to Visualize and Inquire into Essential Elements of Chemical Equilibrium, Ingo Eilks and Ozcan Gulacar, J. Chem. Educ., 2016, 93 (11), pp 1904–1907 DOI: 10.1021/acs.jchemed.6b00252 résumé de M.H. 2016-2017. Lien
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b00958plugin-autotooltip__default plugin-autotooltip_bigÉtude de l'équilibre d’une réaction chimique entre les ions ferriques et les ions iodures en solution aqueuse en utilisant une approche simple et peu coûteuse

Article Studying Equilibrium in the Chemical Reaction between Ferric and Iodide Ions in Solution Using a Simple and Inexpensive Approach Pavel Anatolyevich Nikolaychuk and Alyona Olegovna Kuvaeva, J. Chem. Educ., 2016, 93 (7), pp 1267–1269 DOI: 10.1021/acs.jchemed.5b00958
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed5007162plugin-autotooltip__default plugin-autotooltip_bigEnseigner aux étudiants débutants en chimie les structures de Lewis simples

Article Teaching Beginning Chemistry Students Simple Lewis Dot Structures Peter Nassiff and Wendy A. Czerwinski, J. Chem. Educ., 2015, 92 (8), pp 1409–1411 DOI: 10.1021/ed5007162 résumé de L.R. 2016-2017


Les structures de Lewis conduisent à la compréhension de la liaison chimique et permettent à l’étudiant de construire des molécules simples. Les étudiants qui débutent l’étude de la chimie ont souvent …
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed400091wplugin-autotooltip__default plugin-autotooltip_bigUne méthode efficace pour présenter le tableau périodique comme un jeu de mots croisés au niveau secondaire

Article An Effective Method of Introducing the Periodic Table as a Crossword Puzzle at the High School Level Sushama D. Joag, J. Chem. Educ., 2014, 91 (6), pp 864–867 DOI: 10.1021/ed400091w résumé de J.-L.D. 2016-2017

L’article présente une nouvelle méthode d’apprentissage pour introduire le tableau périodique aux élèves du secondaire. Le public essentiellement visé est celui des ado…
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00263plugin-autotooltip__default plugin-autotooltip_bigExplorations cinétiques du geyser Bonbon-Soda

Article Kinetic Explorations of the Candy–Cola Soda Geyser Trevor P. T. Sims and Thomas S. Kuntzleman, J. Chem. Educ., 2016, 93 (10), pp 1809–1813 DOI: 10.1021/acs.jchemed.6b00263 résumé de E.M. 2016-2017

Cet article aborde l’étude cinétique de la réaction responsable de l’effet geyser du mélange « mentos/boisson gazeuse ».
4 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.8b00296plugin-autotooltip__default plugin-autotooltip_bigContenu pédagogique sur la cinétique chimique: sélection de critères pour aborder expérimentalement les conceptions intuitives des étudiants

Article Pedagogical Content Knowledge of Chemical Kinetics: Experiment Selection Criteria To Address Students’ Intuitive Conceptions Ainoa Marzabal, Virginia Delgado, Patricia Moreira, Lorena Barrientos, and Jeannette Moreno, J. Chem. Educ., 2018, 95 (8), pp 1245–1249 DOI: 10.1021/acs.jchemed.8b00296 résumé de F.G. 2018-2019
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.8b00129plugin-autotooltip__default plugin-autotooltip_bigAnalyse et identification des principaux acides organiques dans les vins et les jus de fruits par chromatographie sur papier

Article Analysis and Identification of Major Organic Acids in Wine and Fruit Juices by Paper Chromatography Dulani Samarasekara, Courtney Hill, and Deb Mlsna, J. Chem. Educ., 2018, 95 (9), pp 1621–1625 DOI: 10.1021/acs.jchemed.8b00129 résumé de A.M. 2018-2019
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.7b00404plugin-autotooltip__default plugin-autotooltip_bigExploration des substances mystérieuses, X et Y: remettre en question l’opinion des étudiants sur la chimie acide-base et l’équilibre chimique

Article Exploring the Mysterious Substances, X and Y: Challenging Students’ Thinking on Acid–Base Chemistry and Chemical Equilibrium Ingo Eilks, Ozcan Gulacar, and Jose Sandoval, J. Chem. Educ., 2018, 95 (4), pp 601–604 DOI: 10.1021/acs.jchemed.7b00404 résumé de A.-C. N. 2018-2019
2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed074p262_10.1039-b801297kplugin-autotooltip__default plugin-autotooltip_bigApproche scientifique de l'enseignement de la chimie

Résumés de A.V.V, 2009-2010 (articles d'intérêt didactique) :

* A.H. Johnstone, Chemistry Teaching – Science or Alchemy 1996 Brasted Lecture, Journal of Chemical Education, 1997, 74, 262-268. DOI: 10.1021/ed074p262 * N. Reid,
1 Occurrences trouvées, Dernière modification:
mapathon2018plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 24 mars 2018

Liens rapides :

* Présentation introductive générale du Mapathon du 24 mars 2018 ! * Les instructions pour faire de la carto humanitaire libre "HOT OSM" * , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site * Tasking manager HOT (identifiez vous) * Choisissez un morceau de territoire à cartographier !
1 Occurrences trouvées, Dernière modification:
polynomes-7plugin-autotooltip__default plugin-autotooltip_bigPolynômes : comment les multiplier par un scalaire et les additionner

#!/usr/bin/env python # -*- coding: UTF-8 -*- """ écriture d'un programme pour évaluer des polynomes + fonction de multiplication d'un polynôme pas un scalaire + fonction d'addition de deux polynômes """ from math import *

def polyeval(x,a): """ application de l'agorithme de Horner cf. """ n = len(a) - 1 # n = ordre du polynôme p =0. for…
1 Occurrences trouvées, Dernière modification:
server_lamp_installplugin-autotooltip__default plugin-autotooltip_bigInstallation d'un serveur LAMP

Le serveur sera installé dans une machine virtuelle (invitée) sous VirtualBox, avec la configuration de deux CMS (Wordpress et Dokuwiki) et d'outils pour la gestion de groupes de personnes ayant différents rôles :
1 Occurrences trouvées, Dernière modification:
root-finding_algorithmplugin-autotooltip__default plugin-autotooltip_bigRoot findings : equations f(x) = 0

* Polynomial equations : Bairstow's method is an efficient algorithm for finding the roots of a real polynomial of arbitrary degree * Polynomials in NumPy * polynomial module, including polyroots(c) to compute the roots of a polynomial.

* Bisection method (dichotomy) : very simple and robust method, but relatively slow. It assumes continuity of the function, and obtain one roots. The algorithm is based on a
1 Occurrences trouvées, Dernière modification:
system_of_linear_equationsplugin-autotooltip__default plugin-autotooltip_bigSystem of linear equations

Time_complexityi.e. Theory

* System_of_linear_equations * Gaussian_elimination, Gauss and Gauss-Jordan eliminations (diagonalization, triangularization) * Pivot_element, pivoting * LU_decomposition * Triangular_matrix

* Chapter 2 in the book “Numerical Recipes” : * 2.0 Introduction * 2.1 Gauss-Jordan Elimination
1 Occurrences trouvées, Dernière modification:
numerical_integrationplugin-autotooltip__default plugin-autotooltip_bigNumerical integration

Error estimation

* Equally spaced methods : * Numerical_integration * Trapezoidal_rule * Newton–Cotes_formulas * Simpson's rule and composite Simpson's rule

* If intervals between interpolation points vary : * Gaussian_quadrature

* Chapter 4 in the book “Numerical Recipes” : Integration of Functions * 4.0 Introduction * 4.1 Classical Formulas for Equally Spaced Abscissas
1 Occurrences trouvées, Dernière modification:
plus_ca_rate_plus_on_a_de_chance_que_ca_marcheplugin-autotooltip__default plugin-autotooltip_bigPlus ça rate, plus on a de chances que ça marche

Exercice basé sur cette devise “Shadoks”, et pas seulement :

Réf :


* Combien d'essais seront-ils nécessaires, en moyenne, pour obtenir une réussite, si la probabilité élémentaire de réussite pour un essai vaut $p$$p$$q = 1-p$$p$$(1-p) p$$(1-p)^2 p$$(1-p)^3 p$$(1-p)^4 p$$(1-p)^{i-1} p$$(1-p) p$$$m = 1 p + 2 (1-p) p + 3 (1-p)^2 p + 4 (1-p)^3 p + 5 (1-p)^4 p + \ldots$$$p$$q =…
1 Occurrences trouvées, Dernière modification:
biblio-10.5923-j.jlce.20170501.03plugin-autotooltip__default plugin-autotooltip_bigActivités de chimie du secondaire avec une composante environnementale: Analyse colorimétrique ionique à coût réduit

Article : High School Chemistry Activities with an Environmental Concern: Cost-Effective Colorimetric Ion Analysis Zahra Arzani and Hassan Hazarkhani, J. Lab. Chem. Educ., 2017, 5(1), pp 9-12 DOI: 10.5923/j.jlce.20170501.03 résumé de F.H. 2017-2018
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b00164plugin-autotooltip__default plugin-autotooltip_bigExploration du contexte quotidien des éléments chimiques : Découvrir les éléments des composants automobiles

Article Exploring the Everyday Context of Chemical Elements: Discovering the Elements of Car Components Antonio Joaquín Franco-Mariscal, J. Chem. Educ., 2015, 92 (10), pp 1672–1677 DOI: 10.1021/acs.jchemed.5b00164 résumé de L.R. 2016-2017
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.5b00729plugin-autotooltip__default plugin-autotooltip_bigConstruction et caractérisation d'un colorimètre compacte, portable, et à bas coût pour le laboratoire de chimie

Article Construction and Characterization of a Compact, Portable, Low-Cost Colorimeter for the Chemistry Lab Carrie M. Clippard, William Hughes, Balwant S. Chohan, Danny G. Sykes, J. Chem. Educ., 2016, 93 (7), pp 1241–1248 DOI: 10.1021/acs.jchemed.5b00729 résumé de A.H. 2016-2017
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed500743rplugin-autotooltip__default plugin-autotooltip_bigL’importance de la métastabilité cinétique: quelques exemples communs

Article The Importance of Kinetic Metastability: Some Common Everyday Examples William B. Jensen, J. Chem. Educ., 2015, 92 (4), pp 649–654 DOI: 10.1021/ed500743r résumé de G.V. 2015-2016


Les manuels de thermodynamiques sont susceptibles de laisser aux étudiants une impression erronée car ils indiquent que la seule exigence pour qu’une réaction chimique spontanée thermodynamiquement se produise est une valeur …
1 Occurrences trouvées, Dernière modification:
biblio-10.1039-b908246hplugin-autotooltip__default plugin-autotooltip_bigLes perceptions des enseignants sur l'enseignement des acides et bases dans l'enseignement secondaire suédois

Teacher’s perceptions of the teaching of acides and bases in Swedish upper secondary schools, Michal Drechsler and Jan Van Driel, Chemistry Education Research and Practice, 2009, 10, 86-96 DOI: 10.1039/B908246H Résumé de L.B., 2010-2011. (accès gratuit possible via le site de la RSC)
1 Occurrences trouvées, Dernière modification:
biblio-10.1039-c0rp90006kplugin-autotooltip__default plugin-autotooltip_bigLes animations peuvent-elles remplacer les méthodes traditionnelles d’enseignement?

Partie I - préparation et tests

Can animations effectively substitute for traditional teaching methods? Part I: preparation and testing of materials Roberto Ma. Gregorius, Rhodora Santos, Judith B. Dano and Jose J. Gutierrez Chem. Educ. Res. Pract., 2010,11, 253-261 DOI: 10.1039/C0RP90006K Résumé de E.V., 2011-2012
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-acs.jchemed.6b00417plugin-autotooltip__default plugin-autotooltip_bigEnquête sur le raisonnement des étudiants face aux réactions acidobasiques

Investigating Students’ Reasoning about Acid–Base Reactions Melanie M. Cooper, Hovig Kouyoumdjian, and Sonia M. Underwood, J. Chem. Educ., 2016, 93 (10), pp 1703–1712 DOI: 10.1021/acs.jchemed.6b00417 Résumé de S.C., 2016-2017
1 Occurrences trouvées, Dernière modification:
scikit_learnplugin-autotooltip__default plugin-autotooltip_bigScikit-learn

* *

FIXME : ajouter des exemples avec analyse de textes contenant des termes scientifiques, des noms de substances chimiques,...

* Scikit-chem, simple cheminformatics for Python * MolMiner, for extracting compounds from scientific literature *
1 Occurrences trouvées, Dernière modification:
mapathon2017plugin-autotooltip__default plugin-autotooltip_bigMapathon à l'UMONS le 25 mars 2017

Liens rapides :

* , le site principal et la carte générée par OpenStreetMap (loin d'être la seule...) → Inscrivez-vous sur le site * Tasking manager HOT (identifiez vous) * Choisissez un morceau de territoire à cartographier !
1 Occurrences trouvées, Dernière modification:
pip-pypiplugin-autotooltip__default plugin-autotooltip_bigInstaller facilement des modules python

AnacaondaPythonxy ...


Des modules additionnels de Python peuvent être installés via des sites qui les proposent. Il s'agit de :

* créateurs de programmes, librairies * firmes ou associations qui proposent des ensembles cohérents (comme
2 Occurrences trouvées, Dernière modification:
qui_a_invente_l_eau_chaudeplugin-autotooltip__default plugin-autotooltip_bigQui a inventé l'eau chaude

Peut-être un cuisinier ?

Atelier autour de la calorimétrie dans une cuisine


La cuisson des aliments permet à l'homme de mieux s'alimenter. L'eau est le milieu le plus largement utilisé pour cuire nos pâtes, légumes, riz, œufs,$m$$c$$T_i$$T_f$$Q = m c (T_f - T_i)$$m$$\Delta H_f$$Q = m \Delta H_f$
1 Occurrences trouvées, Dernière modification:
dosage_titrationplugin-autotooltip__default plugin-autotooltip_bigDosage et titration

FIXME : à formater et illustrer. Ajouter des liens


Le but de cette manipulation est de vous familiariser avec la technique de dosage ou titrage d'acides ou de bases. Pour cela, il est indispensable :

* de connaître l'utilisation de chaque élément de la verrerie mise à votre disposition
1 Occurrences trouvées, Dernière modification:
conference-brey-20160420plugin-autotooltip__default plugin-autotooltip_bigÀ quoi servent les savoirs scolaires ?

Conférence de Bernard Rey, Charleroi, avril 2016

Annonce :

* Les Cafés Conférences de l’Échevinat de l’enseignement de la Ville de Charleroi, en partenariat avec le Centre de Culture scientifique de l’ULB, l’UAE Charleroi-Le Centre , l’Extension de l’ULB, La Ligue de l’Enseignement et de l’Education permanente et Charleroi Danses proposent une conférence de Bernard Rey, Docteur en Sciences de l’Éducation et Professeur honoraire à l’ULB…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed083p954plugin-autotooltip__default plugin-autotooltip_bigFausse conceptions à propos de la nature particulaire de la matière. Utiliser des animations pour combler l'écart entre les genres

Misconceptions about the Particulate Nature of Matter. Using Animations To Close the Gender Gap, Ellen J. Yezierski, James P. Birk, J. Chem. Educ., 2006, 83 (6), p 954 DOI: 10.1021/ed083p954. Résumé X.V., 2012-2013.
1 Occurrences trouvées, Dernière modification:
biblio-10.1039-b5rp90014jplugin-autotooltip__default plugin-autotooltip_bigCompréhension par les élèves des titrages et des phénomènes acide-base reliés

High school students’ understanding of titrations and related acid-base phenomena, K. Sheppard, Chemistry Education Research and Practice, 2006, 7 (1), 32-45. Résumé de A.F., 2011-2012.

L’auteur, K. Sheppard, a voulu mettre en avant les problèmes qui causent l’incompréhension des étudiants face aux phénomènes acide-base qui régissent les titrages. Les causes mises en avant par l’auteur sont l’incompréhension par les …
2 Occurrences trouvées, Dernière modification:
biblio-10.1039-b4rp90027hplugin-autotooltip__default plugin-autotooltip_bigLe laboratoire dans l'enseignement de la chimie : trente ans d'expérience avec des développements, de l'implémentation et de la recherche

The laboratory in chemistry education : thirty years of experience with developments, implementation, and research, Avi Hofstein, Chem. Educ. Res. Pract., 2004, 5, 247-264. Résumé de A.F., 2011-2012. Article d'intérêt didactique
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed076p1136plugin-autotooltip__default plugin-autotooltip_bigApprentissages actif et coopératif dans les cours de chimie organique

Active Learning and Cooperative Learning in the Organic Chemistry Lecture Class, Donald R. Paulson, J. Chem. Educ., 1999, 76 (8), p 1136. Résumé de A.B., 2011-2012. Article d'intérêt didactique


Dans nos universités, bons nombres de cours se présentent sous la forme d'exposés ex-cathedra, de lecture(s), de présentation powerpoint. Cette pratique n'est pas nouvelle, toutefois, nous pourrions nous poser la questio…
1 Occurrences trouvées, Dernière modification:
biblio-9780131493926-chap10plugin-autotooltip__default plugin-autotooltip_bigUne introduction à l'apprentissage en petits groupes

An Introduction to Small-Group Learning, Melanie M. Cooper, Department of Chemistry, Clemson University. chapitre 10 du “Chemists'guide to effective teaching”, Norbert J. Pienta, Melanie M. Cooper, Thomas J. Greenbowe, Pearson Prentice Hall 2005. Résumé de A.P., 2011-2012.
3 Occurrences trouvées, Dernière modification:
biblio-9780131493926-chap9plugin-autotooltip__default plugin-autotooltip_bigRésolution des problèmes en chimie : pourquoi les élèves ont-ils des problèmes et que peut-on faire pour les aider ?

Solving Word Problems in Chemistry: Why Do Students Have Difficulties and What Can Be Done to Help?, Diane M. Bunce, chap 9 du “Chemists'guide to effective teaching”, Pearson Prentice Hall 2005. Résumé de E.V., 2011-2012.
1 Occurrences trouvées, Dernière modification:
biblio-10.1021ed082p313plugin-autotooltip__default plugin-autotooltip_bigExpériences et réflexions à propos de l'enseignement de la structure atomique via une classe puzzle dans l'enseignement secondaire

Experiences and Reflections about Teaching Atomic Structure in a Jigsaw Classroom in Lower Secondary School Chemistry Lessons, Ingo Eilks, J. Chem. Ed. 82(2), pp 313-319,2005. Résumé de A.B. 2010-2011. Article d'intérêt didactique

2 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed084p172plugin-autotooltip__default plugin-autotooltip_bigDeux types de problèmes conceptuels dans l’enseignement de la chimie

Two Kinds of Conceptual Problems in Chemistry Teaching + supplement, Zuzana Haláková and Miroslav Proksa, Journal of Chemical Education Vol. 84 No. 1 January 2007, p 172-174. Résumé de L.B., 2010-2011. Article d'intérêt didactique
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed080p779plugin-autotooltip__default plugin-autotooltip_bigEnseigner la chimie organique via la taxonomie de Bloom ?

Teaching Introductory Organic Chemistry: “Blooming beyond a Simple Taxonomy, M.D. Pungente, R.A. Badger, J.Chem.Educ., 2003, 80, 779. Résumé de D.F. 2010-2011. Article d'intérêt didactique


Souvent, la chimie organique est vue pour la plupart des élèves comme la bête noire des sciences. Ils doivent s’accrocher toute l’année pour passer et espèrent mémoriser suffisamment pour réussir ce cours. Les élèves s’inscrivent en chim…
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed086p1216plugin-autotooltip__default plugin-autotooltip_bigLes séries télévisées médicales comme études de cas en biochimie

Television Medical Dramas as Case Studies in Biochemistry, Julie T. Millard, Journal of Chemical Education • Vol. 86 No. 10 • October 2009 • 1216-1218. Résumé de M.G., 2010-2011.


Le cours biochimie a généralement un rythme soutenu. Les étudiants sont souvent tellement occupés à prendre des notes qu'ils ne réfléchissent pas au sujet du cours. Une rupture de la leçon avec de courtes périodes, obligeant les élèves à ré…
3 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed078p481plugin-autotooltip__default plugin-autotooltip_bigLa chimie dans les films contemporains

Almost Like Weighing Someone’s Soul”: Chemistry in Contemporary Film, Donald J. Wink, J. Chem. Ed.Vol. 78 No. 4 April 2001, pp 481-483. Résumé de V.L., 2009-2010

L’utilisation de courts clips vidéo de différents films populaires constitue un moyen ludique de présenter des exemples « vivants » de théories ou faits importants dans l’enseignement de la chimie. Exemples de films utilisés : Apollo 13, A la poursuite de l’arche perdue, Légende d’automne, the ro…
3 Occurrences trouvées, Dernière modification:
biblio-10.1333-s00897040769aplugin-autotooltip__default plugin-autotooltip_bigDes équilibres acide-base

* Des équilibres acide-base, Partie 1. Les conceptions et les difficultés les plus importantes des étudiants du secondaire - Acid-base Equilibria, Part I. Upper Secondary Students’ Misconceptions and Difficulties, DEMEROUTI M., KOUSATHANA M, TSAPARLIS G., Chemical Educator, 2004, 9, pp 122-131 * Des équilibres acide-base, partie 2. Effets du niveau de développement mental et du style cognitif sur la compréhension conceptuelle et la capacité de résolution des problè…
2 Occurrences trouvées, Dernière modification:
r_pythonplugin-autotooltip__default plugin-autotooltip_bigRéférences spécifiques concernant R et Python

* Rpy2

Références générales sur R

* R, site web officiel * Comprehensive R archive network * An Introduction to R * Rstudio, éditeur spécialisé pour R * rOpenSci

Dans les media

* Programming tools: Adventures with R, Article Nature janvier 2015
1 Occurrences trouvées, Dernière modification:
biblio-10.1021-ed083p1182plugin-autotooltip__default plugin-autotooltip_bigUn laboratoire utilisant des modèles moléculaires pour une introduction en chimie

A laboratory experiment using molecular models for an introductory chemistry class, Shahrokh Ghaffari, J. Chem Ed. Vol. 83 No. 8 Augustus 2006, pp 1182-1184. Sur base d'un résumé de C. B., AESS 2006-2007.

Depuis le milieu du 19ème siècle, l’utilisation de modèles moléculaires est de plus en plus répandue tant dans la recherche scientifique que dans l’enseignement des sciences. En effet, on trouve dans quasi tous …
1 Occurrences trouvées, Dernière modification:
ph_courbe_titrage_2011plugin-autotooltip__default plugin-autotooltip_bigpH et courbe de titrage

#!/usr/bin/env python # -*- coding: utf-8 -*- # Programme de calculs de pH et de courbes de titrages # AD & BW, Ba2 chimie 2010-2011

from math import * from Tkinter import * import matplotlib.pyplot as plt import numpy as np
1 Occurrences trouvées, Dernière modification:
lpi_linux_essentialsplugin-autotooltip__default plugin-autotooltip_bigEtudier et s'autoévaluer en vue d'obtenir le "Linux Essentials Certificate of Achievement"

Document en construction ! (document de travail à usage interne : lpi_linux_essential)

Le document proposé sur ces pages est également disponible sur le wiki de l'ASBL LoLiGrUB, et bénéficie de l'apport d'autres auteurs membres de l'ASBL (Thierry G.,
1 Occurrences trouvées, Dernière modification:
pchplugin-autotooltip__default plugin-autotooltip_bigPhysico-chemical hydrodynamics

English : these works mainly focused on the coupling between thermocapillary and thermogravitational convections. The use of binary alcohol systems presenting unusual dependences of the interfacial or surface tension allowed the study of both positive and negative coupling of the bulk and capillary convections. Some more occasional works have been done on limited studies, like convection implying thermodiffusion (Soret effect), Laser Doppler Velocimetry (LDV), and…
1 Occurrences trouvées, Dernière modification:
  • start.txt
  • Dernière modification: 2020/10/02 14:58
  • de villersd